Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639055_at:

>probe:Drosophila_2:1639055_at:711:121; Interrogation_Position=296; Antisense; AGCGCCGATGATCCGCCGAAAAAAG
>probe:Drosophila_2:1639055_at:155:537; Interrogation_Position=320; Antisense; GGTCTGGATATCGATGTGAATGCCC
>probe:Drosophila_2:1639055_at:208:367; Interrogation_Position=337; Antisense; GAATGCCCAGTTGGCCAAGTTGCTG
>probe:Drosophila_2:1639055_at:395:187; Interrogation_Position=366; Antisense; AACAGAAGCTGCAACCCGCCGTAAA
>probe:Drosophila_2:1639055_at:149:241; Interrogation_Position=402; Antisense; AATACACCGAAGAGGAGCGTCGCAT
>probe:Drosophila_2:1639055_at:126:553; Interrogation_Position=415; Antisense; GGAGCGTCGCATCAAGCAGCAGATT
>probe:Drosophila_2:1639055_at:407:111; Interrogation_Position=432; Antisense; AGCAGATTCTAGCTCAATACTCCCA
>probe:Drosophila_2:1639055_at:223:405; Interrogation_Position=457; Antisense; GACTGCCGTTGCCAACGAGGACGAC
>probe:Drosophila_2:1639055_at:382:445; Interrogation_Position=506; Antisense; GATGACAGTGGAACGCTCACCAAGA
>probe:Drosophila_2:1639055_at:395:165; Interrogation_Position=539; Antisense; AAATCGGATGTCCAGGCGCTAGCCA
>probe:Drosophila_2:1639055_at:370:453; Interrogation_Position=696; Antisense; GATAACCGTCCCCAAGCGAATATTT
>probe:Drosophila_2:1639055_at:159:37; Interrogation_Position=755; Antisense; ATCTGTACAAAGTGCATTTCGCTTG
>probe:Drosophila_2:1639055_at:614:713; Interrogation_Position=785; Antisense; TTGCATGTTTGCCTAAAGCGAAGTA
>probe:Drosophila_2:1639055_at:466:211; Interrogation_Position=817; Antisense; AAGAGATCTACCGAACTGTTGAATA

Paste this into a BLAST search page for me
AGCGCCGATGATCCGCCGAAAAAAGGGTCTGGATATCGATGTGAATGCCCGAATGCCCAGTTGGCCAAGTTGCTGAACAGAAGCTGCAACCCGCCGTAAAAATACACCGAAGAGGAGCGTCGCATGGAGCGTCGCATCAAGCAGCAGATTAGCAGATTCTAGCTCAATACTCCCAGACTGCCGTTGCCAACGAGGACGACGATGACAGTGGAACGCTCACCAAGAAAATCGGATGTCCAGGCGCTAGCCAGATAACCGTCCCCAAGCGAATATTTATCTGTACAAAGTGCATTTCGCTTGTTGCATGTTTGCCTAAAGCGAAGTAAAGAGATCTACCGAACTGTTGAATA

Full Affymetrix probeset data:

Annotations for 1639055_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime