FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639057_at:

>probe:Drosophila_2:1639057_at:395:557; Interrogation_Position=1005; Antisense; GGACTTCTCGGAACACATTTTTCTG
>probe:Drosophila_2:1639057_at:124:697; Interrogation_Position=1024; Antisense; TTTCTGGAACAACATCTCGAGGATT
>probe:Drosophila_2:1639057_at:555:523; Interrogation_Position=1063; Antisense; GGGCCTATTCGCCATTTCATGGAGC
>probe:Drosophila_2:1639057_at:22:293; Interrogation_Position=1089; Antisense; CGTCTGCGTCGGCTTGTCCAAGAAT
>probe:Drosophila_2:1639057_at:65:237; Interrogation_Position=1111; Antisense; AATCCCTACTTGACTGCCCAGGAGA
>probe:Drosophila_2:1639057_at:615:371; Interrogation_Position=1137; Antisense; GAAGGATCACATTTTCTGGTTCCGT
>probe:Drosophila_2:1639057_at:185:589; Interrogation_Position=1153; Antisense; TGGTTCCGTGACTATTTCCAGGCCA
>probe:Drosophila_2:1639057_at:472:571; Interrogation_Position=720; Antisense; GGCTTATCAGCGGTCACAGAGGCAA
>probe:Drosophila_2:1639057_at:355:333; Interrogation_Position=757; Antisense; GCTGAATCCTTTACGGGCAGTGTCA
>probe:Drosophila_2:1639057_at:17:559; Interrogation_Position=795; Antisense; GGAACCGTTGGGTATCTTCAAGGAT
>probe:Drosophila_2:1639057_at:646:711; Interrogation_Position=811; Antisense; TTCAAGGATACCCAGCTGCCGATTT
>probe:Drosophila_2:1639057_at:340:47; Interrogation_Position=844; Antisense; ATCCTTTCAACCTGGTCACAGCTGA
>probe:Drosophila_2:1639057_at:512:191; Interrogation_Position=910; Antisense; AACTACTTCGAGCAAATGGTCCTGT
>probe:Drosophila_2:1639057_at:376:521; Interrogation_Position=954; Antisense; GTGGCGCTTTCCCATCAACAATGAG

Paste this into a BLAST search page for me
GGACTTCTCGGAACACATTTTTCTGTTTCTGGAACAACATCTCGAGGATTGGGCCTATTCGCCATTTCATGGAGCCGTCTGCGTCGGCTTGTCCAAGAATAATCCCTACTTGACTGCCCAGGAGAGAAGGATCACATTTTCTGGTTCCGTTGGTTCCGTGACTATTTCCAGGCCAGGCTTATCAGCGGTCACAGAGGCAAGCTGAATCCTTTACGGGCAGTGTCAGGAACCGTTGGGTATCTTCAAGGATTTCAAGGATACCCAGCTGCCGATTTATCCTTTCAACCTGGTCACAGCTGAAACTACTTCGAGCAAATGGTCCTGTGTGGCGCTTTCCCATCAACAATGAG

Full Affymetrix probeset data:

Annotations for 1639057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720