FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639058_at:

>probe:Drosophila_2:1639058_at:730:209; Interrogation_Position=103; Antisense; AAGATCGACATTAGCACTTGCCAAT
>probe:Drosophila_2:1639058_at:714:717; Interrogation_Position=120; Antisense; TTGCCAATCGAACCGTCCGATGGAA
>probe:Drosophila_2:1639058_at:53:439; Interrogation_Position=138; Antisense; GATGGAATCGCGAACGGCTCCCGAC
>probe:Drosophila_2:1639058_at:486:455; Interrogation_Position=226; Antisense; GATAAAATTTCCGTGCGCTCGATTA
>probe:Drosophila_2:1639058_at:691:387; Interrogation_Position=23; Antisense; GAAAAGCGCACAAGTCCGGCGAGAA
>probe:Drosophila_2:1639058_at:502:291; Interrogation_Position=237; Antisense; CGTGCGCTCGATTAGTTCCGAGGAT
>probe:Drosophila_2:1639058_at:232:585; Interrogation_Position=279; Antisense; TGGAAGATGTTGCAATGCCGCCGCC
>probe:Drosophila_2:1639058_at:201:177; Interrogation_Position=320; Antisense; AAACGGGTCGACGACTGCAGCTGAT
>probe:Drosophila_2:1639058_at:277:271; Interrogation_Position=395; Antisense; CATCGGTGACACTGCAAGAGATCCT
>probe:Drosophila_2:1639058_at:360:101; Interrogation_Position=411; Antisense; AGAGATCCTGGAATACCGTTCCGCT
>probe:Drosophila_2:1639058_at:140:581; Interrogation_Position=437; Antisense; TGGCCGACATCGAGACACAGGTAAG
>probe:Drosophila_2:1639058_at:480:61; Interrogation_Position=455; Antisense; AGGTAAGTGCCATGGAAGTCCTTGT
>probe:Drosophila_2:1639058_at:447:305; Interrogation_Position=474; Antisense; CCTTGTGAAGGGTTCCGGAGCACGA
>probe:Drosophila_2:1639058_at:92:119; Interrogation_Position=498; Antisense; AGCTCGTGGCCAGGCACTCAACTAA

Paste this into a BLAST search page for me
AAGATCGACATTAGCACTTGCCAATTTGCCAATCGAACCGTCCGATGGAAGATGGAATCGCGAACGGCTCCCGACGATAAAATTTCCGTGCGCTCGATTAGAAAAGCGCACAAGTCCGGCGAGAACGTGCGCTCGATTAGTTCCGAGGATTGGAAGATGTTGCAATGCCGCCGCCAAACGGGTCGACGACTGCAGCTGATCATCGGTGACACTGCAAGAGATCCTAGAGATCCTGGAATACCGTTCCGCTTGGCCGACATCGAGACACAGGTAAGAGGTAAGTGCCATGGAAGTCCTTGTCCTTGTGAAGGGTTCCGGAGCACGAAGCTCGTGGCCAGGCACTCAACTAA

Full Affymetrix probeset data:

Annotations for 1639058_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720