FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639060_at:

>probe:Drosophila_2:1639060_at:404:525; Interrogation_Position=341; Antisense; GGGAATTGTACGACTACTGTCTGAA
>probe:Drosophila_2:1639060_at:225:545; Interrogation_Position=412; Antisense; GGATACGAGAACCTATGCTGCCTGC
>probe:Drosophila_2:1639060_at:384:283; Interrogation_Position=433; Antisense; CTGCGCTGCATTCAAACGAGGGACA
>probe:Drosophila_2:1639060_at:228:435; Interrogation_Position=450; Antisense; GAGGGACACCAATTTCGGCACGAAC
>probe:Drosophila_2:1639060_at:144:137; Interrogation_Position=469; Antisense; ACGAACTGCATATGCCGGGTGCCCA
>probe:Drosophila_2:1639060_at:158:317; Interrogation_Position=482; Antisense; GCCGGGTGCCCAAATGCAAACTGGA
>probe:Drosophila_2:1639060_at:67:535; Interrogation_Position=511; Antisense; GGTCGGATCGTTGAGTGTGTCCACT
>probe:Drosophila_2:1639060_at:37:337; Interrogation_Position=548; Antisense; GCTGCTCCGGTTAGATTCCATGTGG
>probe:Drosophila_2:1639060_at:687:629; Interrogation_Position=564; Antisense; TCCATGTGGACGCATTATTGGCATC
>probe:Drosophila_2:1639060_at:703:15; Interrogation_Position=577; Antisense; ATTATTGGCATCTTTATTCGACACA
>probe:Drosophila_2:1639060_at:59:97; Interrogation_Position=641; Antisense; AGATTTCGCCTGATTTCTTCATAGT
>probe:Drosophila_2:1639060_at:381:541; Interrogation_Position=699; Antisense; GGTTAATGGCATGCTAAACATCTAA
>probe:Drosophila_2:1639060_at:587:97; Interrogation_Position=726; Antisense; AGATGCTGCAATAAACCGATTATGT
>probe:Drosophila_2:1639060_at:418:347; Interrogation_Position=761; Antisense; GCATCGTTGGGAAATGCGTTCCGAT

Paste this into a BLAST search page for me
GGGAATTGTACGACTACTGTCTGAAGGATACGAGAACCTATGCTGCCTGCCTGCGCTGCATTCAAACGAGGGACAGAGGGACACCAATTTCGGCACGAACACGAACTGCATATGCCGGGTGCCCAGCCGGGTGCCCAAATGCAAACTGGAGGTCGGATCGTTGAGTGTGTCCACTGCTGCTCCGGTTAGATTCCATGTGGTCCATGTGGACGCATTATTGGCATCATTATTGGCATCTTTATTCGACACAAGATTTCGCCTGATTTCTTCATAGTGGTTAATGGCATGCTAAACATCTAAAGATGCTGCAATAAACCGATTATGTGCATCGTTGGGAAATGCGTTCCGAT

Full Affymetrix probeset data:

Annotations for 1639060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720