FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639061_at:

>probe:Drosophila_2:1639061_at:702:617; Interrogation_Position=6434; Antisense; TGCAGAACAGAAACATCTCCACGCC
>probe:Drosophila_2:1639061_at:381:79; Interrogation_Position=6479; Antisense; AGGTAACGCCGCTGCAGTACAAGTA
>probe:Drosophila_2:1639061_at:348:85; Interrogation_Position=6494; Antisense; AGTACAAGTACTATCCGGGCAACAT
>probe:Drosophila_2:1639061_at:168:527; Interrogation_Position=6510; Antisense; GGGCAACATGAACATCCCGCCAATC
>probe:Drosophila_2:1639061_at:129:33; Interrogation_Position=6532; Antisense; ATCACGTCGGCGCAAAACACGAGTC
>probe:Drosophila_2:1639061_at:719:509; Interrogation_Position=6586; Antisense; GTGCAGCACACGTCGACGCCGATGG
>probe:Drosophila_2:1639061_at:295:25; Interrogation_Position=6623; Antisense; ATAGGACCGCCAATGTCCACATCAG
>probe:Drosophila_2:1639061_at:554:607; Interrogation_Position=6656; Antisense; TGATGGCCCCATACGGAGCGATCAA
>probe:Drosophila_2:1639061_at:309:417; Interrogation_Position=6671; Antisense; GAGCGATCAACAGCTACCGGATGTC
>probe:Drosophila_2:1639061_at:725:321; Interrogation_Position=6711; Antisense; GCCCACTGGAAGCTACAGCTCGGGA
>probe:Drosophila_2:1639061_at:371:311; Interrogation_Position=6746; Antisense; CCAACTCGCAGATTCCGATGCAGAT
>probe:Drosophila_2:1639061_at:80:55; Interrogation_Position=6778; Antisense; ATGCAATCTCAGTACCAGGATGCCT
>probe:Drosophila_2:1639061_at:90:439; Interrogation_Position=6815; Antisense; GAGGCACTCCATCGAACCCGATGTA
>probe:Drosophila_2:1639061_at:167:281; Interrogation_Position=6863; Antisense; CTCTCAACGGTTCTATTCGCAGATA

Paste this into a BLAST search page for me
TGCAGAACAGAAACATCTCCACGCCAGGTAACGCCGCTGCAGTACAAGTAAGTACAAGTACTATCCGGGCAACATGGGCAACATGAACATCCCGCCAATCATCACGTCGGCGCAAAACACGAGTCGTGCAGCACACGTCGACGCCGATGGATAGGACCGCCAATGTCCACATCAGTGATGGCCCCATACGGAGCGATCAAGAGCGATCAACAGCTACCGGATGTCGCCCACTGGAAGCTACAGCTCGGGACCAACTCGCAGATTCCGATGCAGATATGCAATCTCAGTACCAGGATGCCTGAGGCACTCCATCGAACCCGATGTACTCTCAACGGTTCTATTCGCAGATA

Full Affymetrix probeset data:

Annotations for 1639061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720