FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639062_at:

>probe:Drosophila_2:1639062_at:612:173; Interrogation_Position=125; Antisense; AAAGCTCCAGTGCAGCCAGGATCTG
>probe:Drosophila_2:1639062_at:520:187; Interrogation_Position=161; Antisense; AACAGGCCCTCGATCAGAAGTTGGA
>probe:Drosophila_2:1639062_at:388:99; Interrogation_Position=296; Antisense; AGAAGTACGAACTCCAGGTGGCACA
>probe:Drosophila_2:1639062_at:25:533; Interrogation_Position=312; Antisense; GGTGGCACACTTCAATCGAGAGCTG
>probe:Drosophila_2:1639062_at:397:565; Interrogation_Position=359; Antisense; GGAATTCTCTGGACCACATCATGGA
>probe:Drosophila_2:1639062_at:677:235; Interrogation_Position=399; Antisense; AATCGTGCTGGAGGCTAATTTTCTG
>probe:Drosophila_2:1639062_at:228:653; Interrogation_Position=414; Antisense; TAATTTTCTGAGTAAGGCTTCGCGG
>probe:Drosophila_2:1639062_at:242:95; Interrogation_Position=449; Antisense; AGTTGTCAAACACCTGCAGAATCTG
>probe:Drosophila_2:1639062_at:171:209; Interrogation_Position=481; Antisense; AAGCAGTCTGGTTTCAATCACGCCG
>probe:Drosophila_2:1639062_at:577:239; Interrogation_Position=496; Antisense; AATCACGCCGGAGTTTTATTATGCA
>probe:Drosophila_2:1639062_at:408:681; Interrogation_Position=512; Antisense; TATTATGCACTGTCGCTGGAATCGG
>probe:Drosophila_2:1639062_at:117:351; Interrogation_Position=560; Antisense; GCAGTCTGGAGCTGTGCGATGCAAT
>probe:Drosophila_2:1639062_at:670:375; Interrogation_Position=604; Antisense; GAAGACCTGGACACACCAAGTTGCC
>probe:Drosophila_2:1639062_at:6:461; Interrogation_Position=652; Antisense; GATTTCGATGACCTCTTTACGCAGA

Paste this into a BLAST search page for me
AAAGCTCCAGTGCAGCCAGGATCTGAACAGGCCCTCGATCAGAAGTTGGAAGAAGTACGAACTCCAGGTGGCACAGGTGGCACACTTCAATCGAGAGCTGGGAATTCTCTGGACCACATCATGGAAATCGTGCTGGAGGCTAATTTTCTGTAATTTTCTGAGTAAGGCTTCGCGGAGTTGTCAAACACCTGCAGAATCTGAAGCAGTCTGGTTTCAATCACGCCGAATCACGCCGGAGTTTTATTATGCATATTATGCACTGTCGCTGGAATCGGGCAGTCTGGAGCTGTGCGATGCAATGAAGACCTGGACACACCAAGTTGCCGATTTCGATGACCTCTTTACGCAGA

Full Affymetrix probeset data:

Annotations for 1639062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720