FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639063_at:

>probe:Drosophila_2:1639063_at:712:3; Interrogation_Position=247; Antisense; ATTGGAAGTTATGCGCGACTCGGCG
>probe:Drosophila_2:1639063_at:57:497; Interrogation_Position=287; Antisense; GTCAGGAGCAGGTGCTTGGTCTACC
>probe:Drosophila_2:1639063_at:459:91; Interrogation_Position=321; Antisense; CAGTTTTCCGCCCTTGAATTACACG
>probe:Drosophila_2:1639063_at:103:407; Interrogation_Position=354; Antisense; GACGGTGCGTACCAAATTGTCCGCT
>probe:Drosophila_2:1639063_at:592:5; Interrogation_Position=369; Antisense; ATTGTCCGCTCAATTACGCACAACT
>probe:Drosophila_2:1639063_at:299:201; Interrogation_Position=398; Antisense; AACCCATTGCCGAATTGTGCGACAG
>probe:Drosophila_2:1639063_at:260:265; Interrogation_Position=420; Antisense; CAGGATACGCGAGGAGTTCCCGGAC
>probe:Drosophila_2:1639063_at:220:549; Interrogation_Position=456; Antisense; GGAGGCGGACTTAAGCTGCGACCAA
>probe:Drosophila_2:1639063_at:525:115; Interrogation_Position=506; Antisense; AGCATCGCAGCGGTCTGGAGAAATT
>probe:Drosophila_2:1639063_at:57:163; Interrogation_Position=526; Antisense; AAATTGGTTGCGCTTCTCACTCGTA
>probe:Drosophila_2:1639063_at:317:493; Interrogation_Position=548; Antisense; GTAAGTGCACGCTTCTCAAGGAGAC
>probe:Drosophila_2:1639063_at:286:71; Interrogation_Position=623; Antisense; AGGCGCAGGCGCAACTTGTTCAAAC
>probe:Drosophila_2:1639063_at:142:193; Interrogation_Position=656; Antisense; AACTACTGCGCGGATTTTTCGTCCA
>probe:Drosophila_2:1639063_at:409:353; Interrogation_Position=695; Antisense; GCACCGAACATAGCGTCAAGGCACA

Paste this into a BLAST search page for me
ATTGGAAGTTATGCGCGACTCGGCGGTCAGGAGCAGGTGCTTGGTCTACCCAGTTTTCCGCCCTTGAATTACACGGACGGTGCGTACCAAATTGTCCGCTATTGTCCGCTCAATTACGCACAACTAACCCATTGCCGAATTGTGCGACAGCAGGATACGCGAGGAGTTCCCGGACGGAGGCGGACTTAAGCTGCGACCAAAGCATCGCAGCGGTCTGGAGAAATTAAATTGGTTGCGCTTCTCACTCGTAGTAAGTGCACGCTTCTCAAGGAGACAGGCGCAGGCGCAACTTGTTCAAACAACTACTGCGCGGATTTTTCGTCCAGCACCGAACATAGCGTCAAGGCACA

Full Affymetrix probeset data:

Annotations for 1639063_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720