FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639066_at:

>probe:Drosophila_2:1639066_at:614:525; Interrogation_Position=107; Antisense; GGGCACACATATCAGCGGCTTACGA
>probe:Drosophila_2:1639066_at:684:331; Interrogation_Position=121; Antisense; GCGGCTTACGACCTCAACAGTGATA
>probe:Drosophila_2:1639066_at:656:257; Interrogation_Position=160; Antisense; CACAGGGTGGTGCATAATCAAAACA
>probe:Drosophila_2:1639066_at:665:123; Interrogation_Position=190; Antisense; AGCCCAAACAGCTCTCCGAATCAGA
>probe:Drosophila_2:1639066_at:205:711; Interrogation_Position=298; Antisense; TTCTCCGCACACTGGAAAACGCTGC
>probe:Drosophila_2:1639066_at:55:223; Interrogation_Position=39; Antisense; AAGGGCATGGCAACAGGAATCGGAT
>probe:Drosophila_2:1639066_at:108:653; Interrogation_Position=398; Antisense; TCAACGGCAGCAGCACCGATTACAT
>probe:Drosophila_2:1639066_at:542:461; Interrogation_Position=415; Antisense; GATTACATCCTGCTCTATGGCGAAT
>probe:Drosophila_2:1639066_at:136:371; Interrogation_Position=525; Antisense; GAAGGCCAGCGAGTACATCTTTGAT
>probe:Drosophila_2:1639066_at:136:491; Interrogation_Position=537; Antisense; GTACATCTTTGATCGCACCGATGTG
>probe:Drosophila_2:1639066_at:306:655; Interrogation_Position=566; Antisense; TAATATTCATCACACTCTACACACT
>probe:Drosophila_2:1639066_at:607:665; Interrogation_Position=583; Antisense; TACACACTGGTGTTTTGCTGCTGTT
>probe:Drosophila_2:1639066_at:18:695; Interrogation_Position=596; Antisense; TTTGCTGCTGTTTCTTTGGTGAGTA
>probe:Drosophila_2:1639066_at:547:151; Interrogation_Position=81; Antisense; ACATAAGCAGCGATGGCGACCTGAT

Paste this into a BLAST search page for me
GGGCACACATATCAGCGGCTTACGAGCGGCTTACGACCTCAACAGTGATACACAGGGTGGTGCATAATCAAAACAAGCCCAAACAGCTCTCCGAATCAGATTCTCCGCACACTGGAAAACGCTGCAAGGGCATGGCAACAGGAATCGGATTCAACGGCAGCAGCACCGATTACATGATTACATCCTGCTCTATGGCGAATGAAGGCCAGCGAGTACATCTTTGATGTACATCTTTGATCGCACCGATGTGTAATATTCATCACACTCTACACACTTACACACTGGTGTTTTGCTGCTGTTTTTGCTGCTGTTTCTTTGGTGAGTAACATAAGCAGCGATGGCGACCTGAT

Full Affymetrix probeset data:

Annotations for 1639066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720