FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639067_at:

>probe:Drosophila_2:1639067_at:326:21; Interrogation_Position=218; Antisense; ATTTGGCGCAACTGAATCCACTGCT
>probe:Drosophila_2:1639067_at:345:561; Interrogation_Position=259; Antisense; GGAAACACCATTCGGATCATTGCCT
>probe:Drosophila_2:1639067_at:339:391; Interrogation_Position=317; Antisense; GAAAGCCCACATAGGAATCTCCCAC
>probe:Drosophila_2:1639067_at:581:237; Interrogation_Position=332; Antisense; AATCTCCCACCTAGCTAATCTTTGG
>probe:Drosophila_2:1639067_at:709:653; Interrogation_Position=347; Antisense; TAATCTTTGGCGGTTGCTTCTTCCG
>probe:Drosophila_2:1639067_at:144:329; Interrogation_Position=371; Antisense; GCGTATTTCCGGATCTTAAGCCACA
>probe:Drosophila_2:1639067_at:467:709; Interrogation_Position=386; Antisense; TTAAGCCACATCACACACAGTCGGT
>probe:Drosophila_2:1639067_at:120:691; Interrogation_Position=445; Antisense; TTTGTACTTCAATACTGGCAGCAAG
>probe:Drosophila_2:1639067_at:244:161; Interrogation_Position=473; Antisense; ACAAGGTTGGGCTACGGCTATCCAA
>probe:Drosophila_2:1639067_at:694:669; Interrogation_Position=519; Antisense; TTCCAAACTAACCACATTAACCTCT
>probe:Drosophila_2:1639067_at:699:201; Interrogation_Position=537; Antisense; AACCTCTGGACGTAAACTTTCACTG
>probe:Drosophila_2:1639067_at:293:27; Interrogation_Position=580; Antisense; ATAGCTCAATATCTCTGATCACCAT
>probe:Drosophila_2:1639067_at:16:659; Interrogation_Position=629; Antisense; TAAGCCATGTATTCCACCCAAAAAT
>probe:Drosophila_2:1639067_at:118:179; Interrogation_Position=680; Antisense; AAACTTGCCACATGAGCGATTTTTG

Paste this into a BLAST search page for me
ATTTGGCGCAACTGAATCCACTGCTGGAAACACCATTCGGATCATTGCCTGAAAGCCCACATAGGAATCTCCCACAATCTCCCACCTAGCTAATCTTTGGTAATCTTTGGCGGTTGCTTCTTCCGGCGTATTTCCGGATCTTAAGCCACATTAAGCCACATCACACACAGTCGGTTTTGTACTTCAATACTGGCAGCAAGACAAGGTTGGGCTACGGCTATCCAATTCCAAACTAACCACATTAACCTCTAACCTCTGGACGTAAACTTTCACTGATAGCTCAATATCTCTGATCACCATTAAGCCATGTATTCCACCCAAAAATAAACTTGCCACATGAGCGATTTTTG

Full Affymetrix probeset data:

Annotations for 1639067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720