Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639070_a_at:

>probe:Drosophila_2:1639070_a_at:207:229; Interrogation_Position=137; Antisense; AATGTGGAGCAGGTCTAGTCCGTCC
>probe:Drosophila_2:1639070_a_at:528:547; Interrogation_Position=188; Antisense; GGATGGTCCGCATGTGTTACTACCA
>probe:Drosophila_2:1639070_a_at:91:165; Interrogation_Position=227; Antisense; AAATCAGCCAATTTCGACGGCAGCA
>probe:Drosophila_2:1639070_a_at:79:137; Interrogation_Position=273; Antisense; ACGTCCCGACGATTGAAGTTTCTGA
>probe:Drosophila_2:1639070_a_at:494:275; Interrogation_Position=360; Antisense; CTTTCGCACTCGGATTTCGGAATGA
>probe:Drosophila_2:1639070_a_at:296:383; Interrogation_Position=390; Antisense; GAACTGCGAGGCGATTTCCATTGGC
>probe:Drosophila_2:1639070_a_at:276:677; Interrogation_Position=421; Antisense; TAGAGAGCTGGCTTGAGTTTCCCAC
>probe:Drosophila_2:1639070_a_at:104:13; Interrogation_Position=485; Antisense; ATTCTCCCTGAAACTCGGTCTAAGC
>probe:Drosophila_2:1639070_a_at:433:219; Interrogation_Position=522; Antisense; AAGTCCATTTACGACGCGCTGTATG
>probe:Drosophila_2:1639070_a_at:618:299; Interrogation_Position=536; Antisense; CGCGCTGTATGGCATGGGTCTCAAA
>probe:Drosophila_2:1639070_a_at:37:173; Interrogation_Position=558; Antisense; AAAGAGACCTTGAGGCTGGCCTTCA
>probe:Drosophila_2:1639070_a_at:247:429; Interrogation_Position=585; Antisense; GAGTTGCTACACTTGCACTAGCTTT
>probe:Drosophila_2:1639070_a_at:623:537; Interrogation_Position=68; Antisense; GGTCATCGGACTTCGATCACCAGAA
>probe:Drosophila_2:1639070_a_at:467:35; Interrogation_Position=83; Antisense; ATCACCAGAAATTTCCGCGGCTATG

Paste this into a BLAST search page for me
AATGTGGAGCAGGTCTAGTCCGTCCGGATGGTCCGCATGTGTTACTACCAAAATCAGCCAATTTCGACGGCAGCAACGTCCCGACGATTGAAGTTTCTGACTTTCGCACTCGGATTTCGGAATGAGAACTGCGAGGCGATTTCCATTGGCTAGAGAGCTGGCTTGAGTTTCCCACATTCTCCCTGAAACTCGGTCTAAGCAAGTCCATTTACGACGCGCTGTATGCGCGCTGTATGGCATGGGTCTCAAAAAAGAGACCTTGAGGCTGGCCTTCAGAGTTGCTACACTTGCACTAGCTTTGGTCATCGGACTTCGATCACCAGAAATCACCAGAAATTTCCGCGGCTATG

Full Affymetrix probeset data:

Annotations for 1639070_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime