Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639072_at:

>probe:Drosophila_2:1639072_at:541:723; Interrogation_Position=4506; Antisense; TTGACAAAGCGAAAGTCCACACTTT
>probe:Drosophila_2:1639072_at:241:247; Interrogation_Position=4557; Antisense; AATTCTCAACCTACTTTGTGTTATA
>probe:Drosophila_2:1639072_at:319:693; Interrogation_Position=4633; Antisense; TTTGTAATGCCCACACCACGCATAA
>probe:Drosophila_2:1639072_at:479:323; Interrogation_Position=4728; Antisense; GCGAAACGGCAACACACGGTAATTT
>probe:Drosophila_2:1639072_at:259:167; Interrogation_Position=4756; Antisense; AAATGAATGGACGTCGACAGAATCG
>probe:Drosophila_2:1639072_at:28:171; Interrogation_Position=4781; Antisense; AAAGGATGCTGCTGCGATCTGTTCT
>probe:Drosophila_2:1639072_at:37:453; Interrogation_Position=4796; Antisense; GATCTGTTCTGTTCGGCGACTAAGT
>probe:Drosophila_2:1639072_at:37:405; Interrogation_Position=4813; Antisense; GACTAAGTCGAACCGCCTAATCTAC
>probe:Drosophila_2:1639072_at:699:635; Interrogation_Position=4820; Antisense; TCGAACCGCCTAATCTACGCAAAAA
>probe:Drosophila_2:1639072_at:183:151; Interrogation_Position=4855; Antisense; ACATGTGCACATATAGTCGTAAGGT
>probe:Drosophila_2:1639072_at:310:301; Interrogation_Position=4903; Antisense; GCCATTTTAACCTACAATACTTCGA
>probe:Drosophila_2:1639072_at:143:687; Interrogation_Position=4956; Antisense; TATACAAGCCACTATACAAGCCGGT
>probe:Drosophila_2:1639072_at:174:205; Interrogation_Position=4973; Antisense; AAGCCGGTATATGCACAACCACACA
>probe:Drosophila_2:1639072_at:453:157; Interrogation_Position=4995; Antisense; ACACCCGCAGGCACAATAACTTATT

Paste this into a BLAST search page for me
TTGACAAAGCGAAAGTCCACACTTTAATTCTCAACCTACTTTGTGTTATATTTGTAATGCCCACACCACGCATAAGCGAAACGGCAACACACGGTAATTTAAATGAATGGACGTCGACAGAATCGAAAGGATGCTGCTGCGATCTGTTCTGATCTGTTCTGTTCGGCGACTAAGTGACTAAGTCGAACCGCCTAATCTACTCGAACCGCCTAATCTACGCAAAAAACATGTGCACATATAGTCGTAAGGTGCCATTTTAACCTACAATACTTCGATATACAAGCCACTATACAAGCCGGTAAGCCGGTATATGCACAACCACACAACACCCGCAGGCACAATAACTTATT

Full Affymetrix probeset data:

Annotations for 1639072_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime