FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639073_at:

>probe:Drosophila_2:1639073_at:455:627; Interrogation_Position=1018; Antisense; TCACCTTTACCTTGGGTGGGCGTAG
>probe:Drosophila_2:1639073_at:712:523; Interrogation_Position=1035; Antisense; GGGCGTAGATTTTTCCTGGAGTCTC
>probe:Drosophila_2:1639073_at:424:287; Interrogation_Position=1050; Antisense; CTGGAGTCTCACGAGTATGTCTTTC
>probe:Drosophila_2:1639073_at:570:681; Interrogation_Position=1065; Antisense; TATGTCTTTCGGGATATCTACCAGG
>probe:Drosophila_2:1639073_at:263:77; Interrogation_Position=1087; Antisense; AGGATCGAAGGATCTGCTCCTCGGC
>probe:Drosophila_2:1639073_at:485:469; Interrogation_Position=1193; Antisense; GTTCGACATGGAGAGGCATCGCATT
>probe:Drosophila_2:1639073_at:555:3; Interrogation_Position=1215; Antisense; ATTGGATTCGCCGATGCCAGGAGTT
>probe:Drosophila_2:1639073_at:592:467; Interrogation_Position=1237; Antisense; GTTGAGGCCATGTATGCTGTTTGAT
>probe:Drosophila_2:1639073_at:79:441; Interrogation_Position=1259; Antisense; GATGTGCTTCTTGCTTTTTCAACAA
>probe:Drosophila_2:1639073_at:19:197; Interrogation_Position=1282; Antisense; AACTGGTTGCCATAACACGCGAATC
>probe:Drosophila_2:1639073_at:235:565; Interrogation_Position=1355; Antisense; GGCAAATACCCTTTATTCACGTGTT
>probe:Drosophila_2:1639073_at:97:183; Interrogation_Position=1524; Antisense; AAAAGTACTCCGTATCTGATAGTCG
>probe:Drosophila_2:1639073_at:560:629; Interrogation_Position=963; Antisense; TCCTCCTTTGGACAGTTTCTAGTTC
>probe:Drosophila_2:1639073_at:539:677; Interrogation_Position=982; Antisense; TAGTTCCGTGCGACAGCGTACCAGA

Paste this into a BLAST search page for me
TCACCTTTACCTTGGGTGGGCGTAGGGGCGTAGATTTTTCCTGGAGTCTCCTGGAGTCTCACGAGTATGTCTTTCTATGTCTTTCGGGATATCTACCAGGAGGATCGAAGGATCTGCTCCTCGGCGTTCGACATGGAGAGGCATCGCATTATTGGATTCGCCGATGCCAGGAGTTGTTGAGGCCATGTATGCTGTTTGATGATGTGCTTCTTGCTTTTTCAACAAAACTGGTTGCCATAACACGCGAATCGGCAAATACCCTTTATTCACGTGTTAAAAGTACTCCGTATCTGATAGTCGTCCTCCTTTGGACAGTTTCTAGTTCTAGTTCCGTGCGACAGCGTACCAGA

Full Affymetrix probeset data:

Annotations for 1639073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720