FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639074_at:

>probe:Drosophila_2:1639074_at:516:337; Interrogation_Position=3661; Antisense; GCTCCTGGAGCATCGCATCTAGATA
>probe:Drosophila_2:1639074_at:6:167; Interrogation_Position=3692; Antisense; AAATCCCCATTAATAGCTTTAGCAG
>probe:Drosophila_2:1639074_at:590:111; Interrogation_Position=3712; Antisense; AGCAGAACGGTTTCATCGGATCCCA
>probe:Drosophila_2:1639074_at:564:639; Interrogation_Position=3727; Antisense; TCGGATCCCATGTAGTATCATCGTA
>probe:Drosophila_2:1639074_at:459:41; Interrogation_Position=3746; Antisense; ATCGTATTACGTTCGATCGCTAATT
>probe:Drosophila_2:1639074_at:281:291; Interrogation_Position=3818; Antisense; CGTTAATTTGTCATAGTCGCTGCTT
>probe:Drosophila_2:1639074_at:564:25; Interrogation_Position=3830; Antisense; ATAGTCGCTGCTTTTCGTTTTGCCT
>probe:Drosophila_2:1639074_at:713:363; Interrogation_Position=3885; Antisense; GAATTCAGCGTGTCAATGTCGAAGC
>probe:Drosophila_2:1639074_at:359:361; Interrogation_Position=3908; Antisense; GCAAGTTTCATACATATCTAGTTCT
>probe:Drosophila_2:1639074_at:31:645; Interrogation_Position=3924; Antisense; TCTAGTTCTTAGTCCACACAATCGA
>probe:Drosophila_2:1639074_at:143:555; Interrogation_Position=3982; Antisense; GGAGCCATGAGCAGCACCCGAAAAA
>probe:Drosophila_2:1639074_at:117:581; Interrogation_Position=4013; Antisense; TGGCCGATGCCCAACATATCTGAAT
>probe:Drosophila_2:1639074_at:461:365; Interrogation_Position=4034; Antisense; GAATCGAACTTCATTACGTACAGTT
>probe:Drosophila_2:1639074_at:346:467; Interrogation_Position=4060; Antisense; GTTGATATGTAACCTAAGTGCCTAT

Paste this into a BLAST search page for me
GCTCCTGGAGCATCGCATCTAGATAAAATCCCCATTAATAGCTTTAGCAGAGCAGAACGGTTTCATCGGATCCCATCGGATCCCATGTAGTATCATCGTAATCGTATTACGTTCGATCGCTAATTCGTTAATTTGTCATAGTCGCTGCTTATAGTCGCTGCTTTTCGTTTTGCCTGAATTCAGCGTGTCAATGTCGAAGCGCAAGTTTCATACATATCTAGTTCTTCTAGTTCTTAGTCCACACAATCGAGGAGCCATGAGCAGCACCCGAAAAATGGCCGATGCCCAACATATCTGAATGAATCGAACTTCATTACGTACAGTTGTTGATATGTAACCTAAGTGCCTAT

Full Affymetrix probeset data:

Annotations for 1639074_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720