FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639078_at:

>probe:Drosophila_2:1639078_at:570:393; Interrogation_Position=2720; Antisense; GAAATGTGATTCTAGTGCGCTATGA
>probe:Drosophila_2:1639078_at:140:507; Interrogation_Position=2734; Antisense; GTGCGCTATGAATACGCCTTGAGTG
>probe:Drosophila_2:1639078_at:296:229; Interrogation_Position=2946; Antisense; AATGTCATTACTTTTCAGTGTGTAC
>probe:Drosophila_2:1639078_at:179:89; Interrogation_Position=3002; Antisense; AGTACACCCAATTATCCGGGTCCAT
>probe:Drosophila_2:1639078_at:611:631; Interrogation_Position=3016; Antisense; TCCGGGTCCATATTTTGATGACATG
>probe:Drosophila_2:1639078_at:608:605; Interrogation_Position=3031; Antisense; TGATGACATGACCTGTACTTACAAC
>probe:Drosophila_2:1639078_at:583:521; Interrogation_Position=3062; Antisense; GGGCCCCTGGATACGGCTGTTCGAA
>probe:Drosophila_2:1639078_at:717:421; Interrogation_Position=3088; Antisense; GAGAATTACTGACCTATCTCTGGGC
>probe:Drosophila_2:1639078_at:261:39; Interrogation_Position=3103; Antisense; ATCTCTGGGCACTGCCAATAATGAA
>probe:Drosophila_2:1639078_at:79:167; Interrogation_Position=3127; Antisense; AAATGATACTTCTTACTTGGACGTA
>probe:Drosophila_2:1639078_at:581:693; Interrogation_Position=3202; Antisense; TTATAGGTGTATTTATCGGCGGATC
>probe:Drosophila_2:1639078_at:274:685; Interrogation_Position=3215; Antisense; TATCGGCGGATCAAAAGCGGCATAT
>probe:Drosophila_2:1639078_at:451:31; Interrogation_Position=3254; Antisense; ATAACCTCATCCTGTTGTCACATAG
>probe:Drosophila_2:1639078_at:693:109; Interrogation_Position=3277; Antisense; AGCAATCGGGCTAGTCTGGTCTTCC

Paste this into a BLAST search page for me
GAAATGTGATTCTAGTGCGCTATGAGTGCGCTATGAATACGCCTTGAGTGAATGTCATTACTTTTCAGTGTGTACAGTACACCCAATTATCCGGGTCCATTCCGGGTCCATATTTTGATGACATGTGATGACATGACCTGTACTTACAACGGGCCCCTGGATACGGCTGTTCGAAGAGAATTACTGACCTATCTCTGGGCATCTCTGGGCACTGCCAATAATGAAAAATGATACTTCTTACTTGGACGTATTATAGGTGTATTTATCGGCGGATCTATCGGCGGATCAAAAGCGGCATATATAACCTCATCCTGTTGTCACATAGAGCAATCGGGCTAGTCTGGTCTTCC

Full Affymetrix probeset data:

Annotations for 1639078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720