Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639079_at:

>probe:Drosophila_2:1639079_at:283:539; Interrogation_Position=1129; Antisense; GGTATATCAACCAACTGTCCGATCT
>probe:Drosophila_2:1639079_at:561:451; Interrogation_Position=1149; Antisense; GATCTTCCTAGCACGGCAAACTACT
>probe:Drosophila_2:1639079_at:239:587; Interrogation_Position=1225; Antisense; TGGACGCCATTCTGCTGAATACGAA
>probe:Drosophila_2:1639079_at:335:241; Interrogation_Position=1242; Antisense; AATACGAAGCGGATTGGCCATGCCT
>probe:Drosophila_2:1639079_at:292:595; Interrogation_Position=1291; Antisense; TGTGGTCCACCATCAAGAAGCGTAA
>probe:Drosophila_2:1639079_at:278:329; Interrogation_Position=1310; Antisense; GCGTAACATCGCCATCGAGGTGAAT
>probe:Drosophila_2:1639079_at:279:81; Interrogation_Position=1327; Antisense; AGGTGAATCCCATTTCCAACCAGGT
>probe:Drosophila_2:1639079_at:270:79; Interrogation_Position=1348; Antisense; AGGTCTTGGGCTTCGTCTGGGATCT
>probe:Drosophila_2:1639079_at:574:529; Interrogation_Position=1366; Antisense; GGGATCTGCGAAATCATCCGGCCAG
>probe:Drosophila_2:1639079_at:672:261; Interrogation_Position=1388; Antisense; CAGCTTCCTGATAGCCGAGAACTTT
>probe:Drosophila_2:1639079_at:542:383; Interrogation_Position=1406; Antisense; GAACTTTCCCATCGTTATATCATCC
>probe:Drosophila_2:1639079_at:155:531; Interrogation_Position=1457; Antisense; GGGTCTCAGCTACGATTTCTACTAC
>probe:Drosophila_2:1639079_at:459:547; Interrogation_Position=1505; Antisense; GGATGCGGATCTGCGCTTTCTCAAG
>probe:Drosophila_2:1639079_at:523:31; Interrogation_Position=1587; Antisense; ATCAATCGGGTATTCCAGCGCAAGT

Paste this into a BLAST search page for me
GGTATATCAACCAACTGTCCGATCTGATCTTCCTAGCACGGCAAACTACTTGGACGCCATTCTGCTGAATACGAAAATACGAAGCGGATTGGCCATGCCTTGTGGTCCACCATCAAGAAGCGTAAGCGTAACATCGCCATCGAGGTGAATAGGTGAATCCCATTTCCAACCAGGTAGGTCTTGGGCTTCGTCTGGGATCTGGGATCTGCGAAATCATCCGGCCAGCAGCTTCCTGATAGCCGAGAACTTTGAACTTTCCCATCGTTATATCATCCGGGTCTCAGCTACGATTTCTACTACGGATGCGGATCTGCGCTTTCTCAAGATCAATCGGGTATTCCAGCGCAAGT

Full Affymetrix probeset data:

Annotations for 1639079_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime