FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639082_at:

>probe:Drosophila_2:1639082_at:11:413; Interrogation_Position=109; Antisense; GACCCTGACACAACCACGAATGCAA
>probe:Drosophila_2:1639082_at:726:187; Interrogation_Position=132; Antisense; AACATGCAGACATGCCACGGACATG
>probe:Drosophila_2:1639082_at:657:553; Interrogation_Position=168; Antisense; GGACCCCAACATATTCTACGTGTGC
>probe:Drosophila_2:1639082_at:141:671; Interrogation_Position=184; Antisense; TACGTGTGCTCCGATGGCGGACAAC
>probe:Drosophila_2:1639082_at:251:289; Interrogation_Position=201; Antisense; CGGACAACCGCTGCAGCTGGAGTGT
>probe:Drosophila_2:1639082_at:374:461; Interrogation_Position=239; Antisense; GATTTTTCAGCGGTCTCGGTTATCT
>probe:Drosophila_2:1639082_at:721:703; Interrogation_Position=258; Antisense; TTATCTGGGCTGTTTGCCCTATGAC
>probe:Drosophila_2:1639082_at:566:81; Interrogation_Position=314; Antisense; AGGTGGCCGCCCAATTGTCAGCTGG
>probe:Drosophila_2:1639082_at:578:725; Interrogation_Position=328; Antisense; TTGTCAGCTGGCTGTGACACCACTA
>probe:Drosophila_2:1639082_at:462:11; Interrogation_Position=396; Antisense; ATTCTACCTGTGTCCCAGCATAAAT
>probe:Drosophila_2:1639082_at:399:679; Interrogation_Position=453; Antisense; TAGTGGATTCGTGTCCAGTTCCGAG
>probe:Drosophila_2:1639082_at:680:285; Interrogation_Position=486; Antisense; CTGTGCGGACTGGTCACAATGGCGC
>probe:Drosophila_2:1639082_at:354:265; Interrogation_Position=514; Antisense; CAGATGGAGTGCGAGGCGTACTACT
>probe:Drosophila_2:1639082_at:167:607; Interrogation_Position=53; Antisense; TGATCCTGATCCTGACCATGCTGCA

Paste this into a BLAST search page for me
GACCCTGACACAACCACGAATGCAAAACATGCAGACATGCCACGGACATGGGACCCCAACATATTCTACGTGTGCTACGTGTGCTCCGATGGCGGACAACCGGACAACCGCTGCAGCTGGAGTGTGATTTTTCAGCGGTCTCGGTTATCTTTATCTGGGCTGTTTGCCCTATGACAGGTGGCCGCCCAATTGTCAGCTGGTTGTCAGCTGGCTGTGACACCACTAATTCTACCTGTGTCCCAGCATAAATTAGTGGATTCGTGTCCAGTTCCGAGCTGTGCGGACTGGTCACAATGGCGCCAGATGGAGTGCGAGGCGTACTACTTGATCCTGATCCTGACCATGCTGCA

Full Affymetrix probeset data:

Annotations for 1639082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720