Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639083_at:

>probe:Drosophila_2:1639083_at:48:537; Interrogation_Position=8567; Antisense; GGTAACTCGGGCGAACAATGTCTAG
>probe:Drosophila_2:1639083_at:606:131; Interrogation_Position=8571; Antisense; ACTCGGGCGAACAATGTCTAGGACA
>probe:Drosophila_2:1639083_at:176:387; Interrogation_Position=8579; Antisense; GAACAATGTCTAGGACAAGTGTCCA
>probe:Drosophila_2:1639083_at:305:559; Interrogation_Position=8591; Antisense; GGACAAGTGTCCATCTATAAGGTGT
>probe:Drosophila_2:1639083_at:705:515; Interrogation_Position=8597; Antisense; GTGTCCATCTATAAGGTGTGTGTCC
>probe:Drosophila_2:1639083_at:440:37; Interrogation_Position=8603; Antisense; ATCTATAAGGTGTGTGTCCGTTGCC
>probe:Drosophila_2:1639083_at:10:33; Interrogation_Position=8607; Antisense; ATAAGGTGTGTGTCCGTTGCCGCAA
>probe:Drosophila_2:1639083_at:166:81; Interrogation_Position=8610; Antisense; AGGTGTGTGTCCGTTGCCGCAATTG
>probe:Drosophila_2:1639083_at:26:597; Interrogation_Position=8613; Antisense; TGTGTGTCCGTTGCCGCAATTGAAG
>probe:Drosophila_2:1639083_at:231:631; Interrogation_Position=8619; Antisense; TCCGTTGCCGCAATTGAAGAGTTCG
>probe:Drosophila_2:1639083_at:307:469; Interrogation_Position=8622; Antisense; GTTGCCGCAATTGAAGAGTTCGAGA
>probe:Drosophila_2:1639083_at:332:363; Interrogation_Position=8628; Antisense; GCAATTGAAGAGTTCGAGACGTCTA
>probe:Drosophila_2:1639083_at:102:369; Interrogation_Position=8634; Antisense; GAAGAGTTCGAGACGTCTAAAAACA
>probe:Drosophila_2:1639083_at:693:423; Interrogation_Position=8643; Antisense; GAGACGTCTAAAAACAGTCCCAGAA

Paste this into a BLAST search page for me
GGTAACTCGGGCGAACAATGTCTAGACTCGGGCGAACAATGTCTAGGACAGAACAATGTCTAGGACAAGTGTCCAGGACAAGTGTCCATCTATAAGGTGTGTGTCCATCTATAAGGTGTGTGTCCATCTATAAGGTGTGTGTCCGTTGCCATAAGGTGTGTGTCCGTTGCCGCAAAGGTGTGTGTCCGTTGCCGCAATTGTGTGTGTCCGTTGCCGCAATTGAAGTCCGTTGCCGCAATTGAAGAGTTCGGTTGCCGCAATTGAAGAGTTCGAGAGCAATTGAAGAGTTCGAGACGTCTAGAAGAGTTCGAGACGTCTAAAAACAGAGACGTCTAAAAACAGTCCCAGAA

Full Affymetrix probeset data:

Annotations for 1639083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime