FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639085_at:

>probe:Drosophila_2:1639085_at:105:19; Interrogation_Position=1022; Antisense; ATTTCTGTTTTTAGCCTGCATCCGG
>probe:Drosophila_2:1639085_at:6:285; Interrogation_Position=1037; Antisense; CTGCATCCGGGCAATATGGTGTCCA
>probe:Drosophila_2:1639085_at:397:65; Interrogation_Position=1052; Antisense; ATGGTGTCCAGCGATTTGTCACGAA
>probe:Drosophila_2:1639085_at:513:135; Interrogation_Position=1072; Antisense; ACGAAACTATTGGTTCTACCGCCTG
>probe:Drosophila_2:1639085_at:489:207; Interrogation_Position=1137; Antisense; AAGCGGCTGCCACGAGTATCTACTG
>probe:Drosophila_2:1639085_at:121:431; Interrogation_Position=1150; Antisense; GAGTATCTACTGTGCGACGGCCAAC
>probe:Drosophila_2:1639085_at:562:139; Interrogation_Position=1165; Antisense; GACGGCCAACGAGCTGACCGGATTG
>probe:Drosophila_2:1639085_at:243:413; Interrogation_Position=1180; Antisense; GACCGGATTGTCTGGACTGTACTTC
>probe:Drosophila_2:1639085_at:627:651; Interrogation_Position=1203; Antisense; TCAACAATTGCTTCTTCTGCGAGCC
>probe:Drosophila_2:1639085_at:191:623; Interrogation_Position=1220; Antisense; TGCGAGCCCAGCAAGTTGTCCAAAA
>probe:Drosophila_2:1639085_at:598:201; Interrogation_Position=1283; Antisense; AACCTGATTGCCGAGCTTGTGGAGC
>probe:Drosophila_2:1639085_at:654:549; Interrogation_Position=1309; Antisense; GGAGCAGCATTAGCCAAGTCATTTG
>probe:Drosophila_2:1639085_at:504:669; Interrogation_Position=935; Antisense; TACTGGAGCATGATGGCCTACAACA
>probe:Drosophila_2:1639085_at:57:209; Interrogation_Position=965; Antisense; AAGCTATGCAATGTCTTGTTCGCCC

Paste this into a BLAST search page for me
ATTTCTGTTTTTAGCCTGCATCCGGCTGCATCCGGGCAATATGGTGTCCAATGGTGTCCAGCGATTTGTCACGAAACGAAACTATTGGTTCTACCGCCTGAAGCGGCTGCCACGAGTATCTACTGGAGTATCTACTGTGCGACGGCCAACGACGGCCAACGAGCTGACCGGATTGGACCGGATTGTCTGGACTGTACTTCTCAACAATTGCTTCTTCTGCGAGCCTGCGAGCCCAGCAAGTTGTCCAAAAAACCTGATTGCCGAGCTTGTGGAGCGGAGCAGCATTAGCCAAGTCATTTGTACTGGAGCATGATGGCCTACAACAAAGCTATGCAATGTCTTGTTCGCCC

Full Affymetrix probeset data:

Annotations for 1639085_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720