FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639087_at:

>probe:Drosophila_2:1639087_at:217:515; Interrogation_Position=331; Antisense; GTGTACTCCGCTGCCATATTGGAAT
>probe:Drosophila_2:1639087_at:297:221; Interrogation_Position=407; Antisense; AAGTGAAACGTATCACTCCTCGCCA
>probe:Drosophila_2:1639087_at:651:633; Interrogation_Position=440; Antisense; TCGCCATTCGCGGAGACGAGGAGCT
>probe:Drosophila_2:1639087_at:20:455; Interrogation_Position=474; Antisense; GATCAAGGCAACCATCGCTGGTGGC
>probe:Drosophila_2:1639087_at:158:721; Interrogation_Position=506; Antisense; TTCCGCACATACACAAGTCGCTGAT
>probe:Drosophila_2:1639087_at:473:177; Interrogation_Position=545; Antisense; AAACGGTGCAGGATCCGCAGCGGAA
>probe:Drosophila_2:1639087_at:405:371; Interrogation_Position=567; Antisense; GAAGGGCAACGTCATTCTGTCGCAG
>probe:Drosophila_2:1639087_at:307:347; Interrogation_Position=588; Antisense; GCAGGCCTACTAAGCCAGTCGGCAA
>probe:Drosophila_2:1639087_at:166:89; Interrogation_Position=604; Antisense; AGTCGGCAATCGGACGCCTTCGAAA
>probe:Drosophila_2:1639087_at:201:135; Interrogation_Position=617; Antisense; ACGCCTTCGAAACATGCAACACTAA
>probe:Drosophila_2:1639087_at:269:95; Interrogation_Position=685; Antisense; AGTTGTAATCATTTCTGTGCGCCAG
>probe:Drosophila_2:1639087_at:461:597; Interrogation_Position=700; Antisense; TGTGCGCCAGCATATATTTCTTATA
>probe:Drosophila_2:1639087_at:248:681; Interrogation_Position=743; Antisense; TATGTAATTCTAGCATCTCCCCAAC
>probe:Drosophila_2:1639087_at:225:355; Interrogation_Position=818; Antisense; GCACGCATCCTTGGCGAGGTTGAGT

Paste this into a BLAST search page for me
GTGTACTCCGCTGCCATATTGGAATAAGTGAAACGTATCACTCCTCGCCATCGCCATTCGCGGAGACGAGGAGCTGATCAAGGCAACCATCGCTGGTGGCTTCCGCACATACACAAGTCGCTGATAAACGGTGCAGGATCCGCAGCGGAAGAAGGGCAACGTCATTCTGTCGCAGGCAGGCCTACTAAGCCAGTCGGCAAAGTCGGCAATCGGACGCCTTCGAAAACGCCTTCGAAACATGCAACACTAAAGTTGTAATCATTTCTGTGCGCCAGTGTGCGCCAGCATATATTTCTTATATATGTAATTCTAGCATCTCCCCAACGCACGCATCCTTGGCGAGGTTGAGT

Full Affymetrix probeset data:

Annotations for 1639087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720