Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639090_a_at:

>probe:Drosophila_2:1639090_a_at:49:587; Interrogation_Position=100; Antisense; TGGACAGTTCATTCAGTGCCCGTAA
>probe:Drosophila_2:1639090_a_at:485:399; Interrogation_Position=102; Antisense; GACAGTTCATTCAGTGCCCGTAAAG
>probe:Drosophila_2:1639090_a_at:24:153; Interrogation_Position=103; Antisense; ACAGTTCATTCAGTGCCCGTAAAGC
>probe:Drosophila_2:1639090_a_at:29:93; Interrogation_Position=105; Antisense; AGTTCATTCAGTGCCCGTAAAGCGT
>probe:Drosophila_2:1639090_a_at:664:615; Interrogation_Position=383; Antisense; TGCCCGGCACGGCAGCAAGCTGCGG
>probe:Drosophila_2:1639090_a_at:516:709; Interrogation_Position=462; Antisense; TTCAGTGATGCCCACAGTATCCAGG
>probe:Drosophila_2:1639090_a_at:269:649; Interrogation_Position=463; Antisense; TCAGTGATGCCCACAGTATCCAGGG
>probe:Drosophila_2:1639090_a_at:39:363; Interrogation_Position=524; Antisense; GAATAAACGCCGATACCAACAGCAC
>probe:Drosophila_2:1639090_a_at:111:201; Interrogation_Position=529; Antisense; AACGCCGATACCAACAGCACGGACA
>probe:Drosophila_2:1639090_a_at:252:651; Interrogation_Position=557; Antisense; TCAAGAAGAACGACGGAAGCAATTA
>probe:Drosophila_2:1639090_a_at:640:337; Interrogation_Position=68; Antisense; GCTCTGCACAGGTGCCGCCAACTGT
>probe:Drosophila_2:1639090_a_at:319:79; Interrogation_Position=77; Antisense; AGGTGCCGCCAACTGTCAGTTCATG
>probe:Drosophila_2:1639090_a_at:363:473; Interrogation_Position=95; Antisense; GTTCATGGACAGTTCATTCAGTGCC
>probe:Drosophila_2:1639090_a_at:296:269; Interrogation_Position=98; Antisense; CATGGACAGTTCATTCAGTGCCCGT

Paste this into a BLAST search page for me
TGGACAGTTCATTCAGTGCCCGTAAGACAGTTCATTCAGTGCCCGTAAAGACAGTTCATTCAGTGCCCGTAAAGCAGTTCATTCAGTGCCCGTAAAGCGTTGCCCGGCACGGCAGCAAGCTGCGGTTCAGTGATGCCCACAGTATCCAGGTCAGTGATGCCCACAGTATCCAGGGGAATAAACGCCGATACCAACAGCACAACGCCGATACCAACAGCACGGACATCAAGAAGAACGACGGAAGCAATTAGCTCTGCACAGGTGCCGCCAACTGTAGGTGCCGCCAACTGTCAGTTCATGGTTCATGGACAGTTCATTCAGTGCCCATGGACAGTTCATTCAGTGCCCGT

Full Affymetrix probeset data:

Annotations for 1639090_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime