FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639091_at:

>probe:Drosophila_2:1639091_at:699:553; Interrogation_Position=1317; Antisense; GGAGCTGATCAACTTCGACACATTT
>probe:Drosophila_2:1639091_at:3:147; Interrogation_Position=1349; Antisense; ACTTTGGGCTCGTGTTGGCTGAAAA
>probe:Drosophila_2:1639091_at:379:483; Interrogation_Position=1412; Antisense; GTATCACCGAGCTTAAGGATCGTCT
>probe:Drosophila_2:1639091_at:17:347; Interrogation_Position=1454; Antisense; GCATCATTGCCATGTATTACTCCCG
>probe:Drosophila_2:1639091_at:301:21; Interrogation_Position=1484; Antisense; ATTTGGCGCGCATGAGTGAGCTGCT
>probe:Drosophila_2:1639091_at:366:125; Interrogation_Position=1522; Antisense; AGCCGCTGCGAGGAGTATCTTTCTA
>probe:Drosophila_2:1639091_at:570:481; Interrogation_Position=1536; Antisense; GTATCTTTCTAAACTGGCCAACACC
>probe:Drosophila_2:1639091_at:315:289; Interrogation_Position=1593; Antisense; CGGCATCATTTACTTCACCCAAAAA
>probe:Drosophila_2:1639091_at:365:263; Interrogation_Position=1663; Antisense; CAGCTGATGTCCCTGGTCAACAAGA
>probe:Drosophila_2:1639091_at:363:73; Interrogation_Position=1706; Antisense; AGGAAGAGTGCGTCTACTCCGTCAT
>probe:Drosophila_2:1639091_at:289:305; Interrogation_Position=1724; Antisense; CCGTCATGTGTGCTGTCGAGGATTA
>probe:Drosophila_2:1639091_at:541:461; Interrogation_Position=1744; Antisense; GATTAATCCTGTTCCATAGGTGCTT
>probe:Drosophila_2:1639091_at:409:653; Interrogation_Position=1812; Antisense; TAATTGTACTAACCCCTAACCATCA
>probe:Drosophila_2:1639091_at:634:125; Interrogation_Position=1830; Antisense; ACCATCAACATTTCGATTCTCTTCG

Paste this into a BLAST search page for me
GGAGCTGATCAACTTCGACACATTTACTTTGGGCTCGTGTTGGCTGAAAAGTATCACCGAGCTTAAGGATCGTCTGCATCATTGCCATGTATTACTCCCGATTTGGCGCGCATGAGTGAGCTGCTAGCCGCTGCGAGGAGTATCTTTCTAGTATCTTTCTAAACTGGCCAACACCCGGCATCATTTACTTCACCCAAAAACAGCTGATGTCCCTGGTCAACAAGAAGGAAGAGTGCGTCTACTCCGTCATCCGTCATGTGTGCTGTCGAGGATTAGATTAATCCTGTTCCATAGGTGCTTTAATTGTACTAACCCCTAACCATCAACCATCAACATTTCGATTCTCTTCG

Full Affymetrix probeset data:

Annotations for 1639091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720