Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639092_at:

>probe:Drosophila_2:1639092_at:361:339; Interrogation_Position=1003; Antisense; GCTAATCACTCGTGGCGAGACCAGT
>probe:Drosophila_2:1639092_at:153:519; Interrogation_Position=1028; Antisense; GTGGAGGCTCACATCAACGAAGCTG
>probe:Drosophila_2:1639092_at:544:655; Interrogation_Position=1090; Antisense; TAATCCTTATAACTTTGGCACCAAA
>probe:Drosophila_2:1639092_at:344:143; Interrogation_Position=1119; Antisense; ACTGGAAGCTGTTCTTGGGTCTGGT
>probe:Drosophila_2:1639092_at:104:49; Interrogation_Position=1153; Antisense; ATCCTTTTGGCGAACTGTGCTGCTT
>probe:Drosophila_2:1639092_at:130:287; Interrogation_Position=1203; Antisense; CTGGGCTGAGTTTCCACACGGTAAA
>probe:Drosophila_2:1639092_at:485:153; Interrogation_Position=1218; Antisense; ACACGGTAAATGATGCTCCCTTCGA
>probe:Drosophila_2:1639092_at:283:555; Interrogation_Position=1243; Antisense; GGACGAGTGGCCATAATTCCAACAT
>probe:Drosophila_2:1639092_at:446:379; Interrogation_Position=1269; Antisense; GAAGCCATTGTGATGTCAGCAAGTC
>probe:Drosophila_2:1639092_at:643:599; Interrogation_Position=1415; Antisense; TGTACTTTGTTTCCATGACGACTAG
>probe:Drosophila_2:1639092_at:214:565; Interrogation_Position=1445; Antisense; GGCACAATGACGCTTTTATACTACT
>probe:Drosophila_2:1639092_at:107:537; Interrogation_Position=917; Antisense; GGTCGACGACGAGCGCTTTGGTTCA
>probe:Drosophila_2:1639092_at:82:323; Interrogation_Position=929; Antisense; GCGCTTTGGTTCATGGCGTTCACAA
>probe:Drosophila_2:1639092_at:111:473; Interrogation_Position=946; Antisense; GTTCACAAACGTTGCCGTGGTCTTG

Paste this into a BLAST search page for me
GCTAATCACTCGTGGCGAGACCAGTGTGGAGGCTCACATCAACGAAGCTGTAATCCTTATAACTTTGGCACCAAAACTGGAAGCTGTTCTTGGGTCTGGTATCCTTTTGGCGAACTGTGCTGCTTCTGGGCTGAGTTTCCACACGGTAAAACACGGTAAATGATGCTCCCTTCGAGGACGAGTGGCCATAATTCCAACATGAAGCCATTGTGATGTCAGCAAGTCTGTACTTTGTTTCCATGACGACTAGGGCACAATGACGCTTTTATACTACTGGTCGACGACGAGCGCTTTGGTTCAGCGCTTTGGTTCATGGCGTTCACAAGTTCACAAACGTTGCCGTGGTCTTG

Full Affymetrix probeset data:

Annotations for 1639092_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime