FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639094_at:

>probe:Drosophila_2:1639094_at:372:669; Interrogation_Position=481; Antisense; TACTCTCTGTCTTTCTGGGCATGTT
>probe:Drosophila_2:1639094_at:702:675; Interrogation_Position=515; Antisense; TAGATTCTATTTGGGCTATCCGGGC
>probe:Drosophila_2:1639094_at:93:721; Interrogation_Position=576; Antisense; TTCCTGGGCCAGCTGATTGACATCG
>probe:Drosophila_2:1639094_at:709:5; Interrogation_Position=591; Antisense; ATTGACATCGTGCTGATAGCCCTGC
>probe:Drosophila_2:1639094_at:617:681; Interrogation_Position=645; Antisense; TATGTGATACCCTACTACGGAGCCG
>probe:Drosophila_2:1639094_at:346:357; Interrogation_Position=740; Antisense; GCACAGCGCCTGGTGTACAGTAGAT
>probe:Drosophila_2:1639094_at:77:623; Interrogation_Position=824; Antisense; TGCGGATCCGTTCCGATCGAACAAT
>probe:Drosophila_2:1639094_at:115:187; Interrogation_Position=843; Antisense; AACAATGGATCGCTTCGGTTCGGAT
>probe:Drosophila_2:1639094_at:23:425; Interrogation_Position=869; Antisense; GAGACTCCGGATTAGTGCATTACGT
>probe:Drosophila_2:1639094_at:652:13; Interrogation_Position=887; Antisense; ATTACGTACCCTCCTAGTTGATAAG
>probe:Drosophila_2:1639094_at:709:481; Interrogation_Position=913; Antisense; GTATAGATTGTTGCCACCCTTCCTT
>probe:Drosophila_2:1639094_at:462:711; Interrogation_Position=932; Antisense; TTCCTTTGCGTAGCCTAAGTTGCAT
>probe:Drosophila_2:1639094_at:729:471; Interrogation_Position=969; Antisense; GTTACCAATGTACATGGTCCCTCAT
>probe:Drosophila_2:1639094_at:384:503; Interrogation_Position=985; Antisense; GTCCCTCATACAATTCTACATCTAT

Paste this into a BLAST search page for me
TACTCTCTGTCTTTCTGGGCATGTTTAGATTCTATTTGGGCTATCCGGGCTTCCTGGGCCAGCTGATTGACATCGATTGACATCGTGCTGATAGCCCTGCTATGTGATACCCTACTACGGAGCCGGCACAGCGCCTGGTGTACAGTAGATTGCGGATCCGTTCCGATCGAACAATAACAATGGATCGCTTCGGTTCGGATGAGACTCCGGATTAGTGCATTACGTATTACGTACCCTCCTAGTTGATAAGGTATAGATTGTTGCCACCCTTCCTTTTCCTTTGCGTAGCCTAAGTTGCATGTTACCAATGTACATGGTCCCTCATGTCCCTCATACAATTCTACATCTAT

Full Affymetrix probeset data:

Annotations for 1639094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720