FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639095_at:

>probe:Drosophila_2:1639095_at:491:727; Interrogation_Position=2514; Antisense; TTGGGCGCTTTTTCGAACACTCATA
>probe:Drosophila_2:1639095_at:137:73; Interrogation_Position=2544; Antisense; AGGAACCGATGCAATTCCCTTGGCT
>probe:Drosophila_2:1639095_at:556:593; Interrogation_Position=2571; Antisense; TGGGCTCTTCAGTCGCGACATTTAT
>probe:Drosophila_2:1639095_at:412:683; Interrogation_Position=2593; Antisense; TATCTGGAGGGAATGCGTCGACGCT
>probe:Drosophila_2:1639095_at:402:363; Interrogation_Position=2619; Antisense; GAATAACCAATATAGCGGCGCCTCC
>probe:Drosophila_2:1639095_at:55:283; Interrogation_Position=2640; Antisense; CTCCGCCGTTTGTGTGTTGCAGTAA
>probe:Drosophila_2:1639095_at:123:299; Interrogation_Position=2704; Antisense; CGCCTACCCACGTTGAAATCTATTT
>probe:Drosophila_2:1639095_at:321:171; Interrogation_Position=2760; Antisense; AAAGCTTTCCTACGGTTGTGCGACG
>probe:Drosophila_2:1639095_at:633:407; Interrogation_Position=2781; Antisense; GACGCCTTTGTATTAACCCGATTAG
>probe:Drosophila_2:1639095_at:489:705; Interrogation_Position=2802; Antisense; TTAGATTGTTATCCAGTGCGCTGTC
>probe:Drosophila_2:1639095_at:412:11; Interrogation_Position=2851; Antisense; ATTACTTACCCTGCAATGCTGCGGT
>probe:Drosophila_2:1639095_at:675:633; Interrogation_Position=2895; Antisense; TCGCCTCGAGGCCTTAGTCGTAATA
>probe:Drosophila_2:1639095_at:70:639; Interrogation_Position=2949; Antisense; TCGTGCAACAATTCTGTACCTCTAC
>probe:Drosophila_2:1639095_at:584:487; Interrogation_Position=2964; Antisense; GTACCTCTACTCTGAAGCACAAGCT

Paste this into a BLAST search page for me
TTGGGCGCTTTTTCGAACACTCATAAGGAACCGATGCAATTCCCTTGGCTTGGGCTCTTCAGTCGCGACATTTATTATCTGGAGGGAATGCGTCGACGCTGAATAACCAATATAGCGGCGCCTCCCTCCGCCGTTTGTGTGTTGCAGTAACGCCTACCCACGTTGAAATCTATTTAAAGCTTTCCTACGGTTGTGCGACGGACGCCTTTGTATTAACCCGATTAGTTAGATTGTTATCCAGTGCGCTGTCATTACTTACCCTGCAATGCTGCGGTTCGCCTCGAGGCCTTAGTCGTAATATCGTGCAACAATTCTGTACCTCTACGTACCTCTACTCTGAAGCACAAGCT

Full Affymetrix probeset data:

Annotations for 1639095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720