FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639096_at:

>probe:Drosophila_2:1639096_at:503:579; Interrogation_Position=261; Antisense; GGCCAAGTACACTGCTGCTCCTTTT
>probe:Drosophila_2:1639096_at:532:89; Interrogation_Position=266; Antisense; AGTACACTGCTGCTCCTTTTGCCTA
>probe:Drosophila_2:1639096_at:75:145; Interrogation_Position=271; Antisense; ACTGCTGCTCCTTTTGCCTACGCTT
>probe:Drosophila_2:1639096_at:621:627; Interrogation_Position=279; Antisense; TCCTTTTGCCTACGCTTCTCCTTTG
>probe:Drosophila_2:1639096_at:442:719; Interrogation_Position=284; Antisense; TTGCCTACGCTTCTCCTTTGGCCTA
>probe:Drosophila_2:1639096_at:413:631; Interrogation_Position=315; Antisense; TCCTCTGGCTTACACTTCTCCATTG
>probe:Drosophila_2:1639096_at:146:583; Interrogation_Position=320; Antisense; TGGCTTACACTTCTCCATTGGCTTA
>probe:Drosophila_2:1639096_at:343:343; Interrogation_Position=322; Antisense; GCTTACACTTCTCCATTGGCTTATA
>probe:Drosophila_2:1639096_at:34:709; Interrogation_Position=324; Antisense; TTACACTTCTCCATTGGCTTATAAA
>probe:Drosophila_2:1639096_at:497:155; Interrogation_Position=326; Antisense; ACACTTCTCCATTGGCTTATAAAAC
>probe:Drosophila_2:1639096_at:266:341; Interrogation_Position=340; Antisense; GCTTATAAAACTCTTCCGGCTGCTG
>probe:Drosophila_2:1639096_at:128:705; Interrogation_Position=342; Antisense; TTATAAAACTCTTCCGGCTGCTGCT
>probe:Drosophila_2:1639096_at:123:687; Interrogation_Position=343; Antisense; TATAAAACTCTTCCGGCTGCTGCTC
>probe:Drosophila_2:1639096_at:669:177; Interrogation_Position=347; Antisense; AAACTCTTCCGGCTGCTGCTCCAGT

Paste this into a BLAST search page for me
GGCCAAGTACACTGCTGCTCCTTTTAGTACACTGCTGCTCCTTTTGCCTAACTGCTGCTCCTTTTGCCTACGCTTTCCTTTTGCCTACGCTTCTCCTTTGTTGCCTACGCTTCTCCTTTGGCCTATCCTCTGGCTTACACTTCTCCATTGTGGCTTACACTTCTCCATTGGCTTAGCTTACACTTCTCCATTGGCTTATATTACACTTCTCCATTGGCTTATAAAACACTTCTCCATTGGCTTATAAAACGCTTATAAAACTCTTCCGGCTGCTGTTATAAAACTCTTCCGGCTGCTGCTTATAAAACTCTTCCGGCTGCTGCTCAAACTCTTCCGGCTGCTGCTCCAGT

Full Affymetrix probeset data:

Annotations for 1639096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720