Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639097_at:

>probe:Drosophila_2:1639097_at:729:313; Interrogation_Position=1660; Antisense; GCCATTGCAGCAACCCAGGGTGCGT
>probe:Drosophila_2:1639097_at:608:505; Interrogation_Position=1679; Antisense; GTGCGTCCTCCGTTGCGGGAATGCC
>probe:Drosophila_2:1639097_at:177:369; Interrogation_Position=1697; Antisense; GAATGCCGTCAGCAGAGGGTCTATA
>probe:Drosophila_2:1639097_at:385:199; Interrogation_Position=1793; Antisense; AACGCCTCCACGTGCAACGACAAAA
>probe:Drosophila_2:1639097_at:265:317; Interrogation_Position=1842; Antisense; GCCTGTGGTCGCTGATGAGTTCCAT
>probe:Drosophila_2:1639097_at:267:57; Interrogation_Position=1856; Antisense; ATGAGTTCCATGATGCGACTGCCGG
>probe:Drosophila_2:1639097_at:303:423; Interrogation_Position=1937; Antisense; GAGAACGCTGGTTCGGGCTCACTCA
>probe:Drosophila_2:1639097_at:321:267; Interrogation_Position=2002; Antisense; CAGTGCAAGGGACTCCTCCATGGAG
>probe:Drosophila_2:1639097_at:425:75; Interrogation_Position=2025; Antisense; AGGACCAGCAGTGCCTCAAGAGAAA
>probe:Drosophila_2:1639097_at:49:393; Interrogation_Position=2046; Antisense; GAAAGCGCACTCAGACGCTGGACAG
>probe:Drosophila_2:1639097_at:688:585; Interrogation_Position=2064; Antisense; TGGACAGCCAGTACTGTAGCCCGCT
>probe:Drosophila_2:1639097_at:334:347; Interrogation_Position=2145; Antisense; GCATGCGTCGCCAGTAGGTTTTAAG
>probe:Drosophila_2:1639097_at:306:539; Interrogation_Position=2161; Antisense; GGTTTTAAGCTTTTGCCTGCGAATC
>probe:Drosophila_2:1639097_at:284:317; Interrogation_Position=2175; Antisense; GCCTGCGAATCTGTGTTTTAATTGT

Paste this into a BLAST search page for me
GCCATTGCAGCAACCCAGGGTGCGTGTGCGTCCTCCGTTGCGGGAATGCCGAATGCCGTCAGCAGAGGGTCTATAAACGCCTCCACGTGCAACGACAAAAGCCTGTGGTCGCTGATGAGTTCCATATGAGTTCCATGATGCGACTGCCGGGAGAACGCTGGTTCGGGCTCACTCACAGTGCAAGGGACTCCTCCATGGAGAGGACCAGCAGTGCCTCAAGAGAAAGAAAGCGCACTCAGACGCTGGACAGTGGACAGCCAGTACTGTAGCCCGCTGCATGCGTCGCCAGTAGGTTTTAAGGGTTTTAAGCTTTTGCCTGCGAATCGCCTGCGAATCTGTGTTTTAATTGT

Full Affymetrix probeset data:

Annotations for 1639097_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime