Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639098_s_at:

>probe:Drosophila_2:1639098_s_at:441:191; Interrogation_Position=433; Antisense; AACTTTATCGCCAGCAGGTGATGGA
>probe:Drosophila_2:1639098_s_at:108:427; Interrogation_Position=465; Antisense; GAGAGATTGATGACGTCCACGGAGA
>probe:Drosophila_2:1639098_s_at:89:283; Interrogation_Position=507; Antisense; CTGCAGGCCTGGTCGAATGGCATGA
>probe:Drosophila_2:1639098_s_at:663:95; Interrogation_Position=617; Antisense; AGATCCCACCAGTGCCATGAAGCAG
>probe:Drosophila_2:1639098_s_at:291:469; Interrogation_Position=647; Antisense; GTTGCTCTACAAAATGGCCACCAGT
>probe:Drosophila_2:1639098_s_at:689:187; Interrogation_Position=692; Antisense; AACAGTGCCTCCTGTCTTTACAGGA
>probe:Drosophila_2:1639098_s_at:403:449; Interrogation_Position=718; Antisense; GATCCCTTAATTTGGGTGGTCCAAG
>probe:Drosophila_2:1639098_s_at:122:533; Interrogation_Position=732; Antisense; GGTGGTCCAAGTGGCTTTAAGCTGC
>probe:Drosophila_2:1639098_s_at:43:621; Interrogation_Position=764; Antisense; TGCTCTTAGCCAGGATACCAATACG
>probe:Drosophila_2:1639098_s_at:406:609; Interrogation_Position=790; Antisense; TGAGCAATCCTGATCCTCTCAAGAG
>probe:Drosophila_2:1639098_s_at:625:407; Interrogation_Position=857; Antisense; GACGGACACTTAGGTTGTGCGCTTA
>probe:Drosophila_2:1639098_s_at:507:541; Interrogation_Position=869; Antisense; GGTTGTGCGCTTATCTAGTTACTAA
>probe:Drosophila_2:1639098_s_at:525:27; Interrogation_Position=911; Antisense; ATACTTGTGTATTTGGGTGCTTAGC
>probe:Drosophila_2:1639098_s_at:301:485; Interrogation_Position=949; Antisense; GTATGGCTTAGCTATCTTTTGTAAA

Paste this into a BLAST search page for me
AACTTTATCGCCAGCAGGTGATGGAGAGAGATTGATGACGTCCACGGAGACTGCAGGCCTGGTCGAATGGCATGAAGATCCCACCAGTGCCATGAAGCAGGTTGCTCTACAAAATGGCCACCAGTAACAGTGCCTCCTGTCTTTACAGGAGATCCCTTAATTTGGGTGGTCCAAGGGTGGTCCAAGTGGCTTTAAGCTGCTGCTCTTAGCCAGGATACCAATACGTGAGCAATCCTGATCCTCTCAAGAGGACGGACACTTAGGTTGTGCGCTTAGGTTGTGCGCTTATCTAGTTACTAAATACTTGTGTATTTGGGTGCTTAGCGTATGGCTTAGCTATCTTTTGTAAA

Full Affymetrix probeset data:

Annotations for 1639098_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime