FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639101_at:

>probe:Drosophila_2:1639101_at:271:667; Interrogation_Position=223; Antisense; TACTAAGGCTCCGATGACCCAGTGG
>probe:Drosophila_2:1639101_at:296:411; Interrogation_Position=272; Antisense; GACGCATTGCTGAAGGTGACCGATA
>probe:Drosophila_2:1639101_at:105:27; Interrogation_Position=294; Antisense; ATACGCGCAGATCGGTGCAACAGCT
>probe:Drosophila_2:1639101_at:587:305; Interrogation_Position=337; Antisense; CCTGGTTGGCAGGAGCACCGATTTG
>probe:Drosophila_2:1639101_at:88:547; Interrogation_Position=487; Antisense; GGATCCAAACAATCTCGGAGGCATT
>probe:Drosophila_2:1639101_at:178:343; Interrogation_Position=507; Antisense; GCATTCGAAGCCTGGAGTACGTACT
>probe:Drosophila_2:1639101_at:475:487; Interrogation_Position=523; Antisense; GTACGTACTCCTGAAGTTGGCTCTA
>probe:Drosophila_2:1639101_at:717:465; Interrogation_Position=538; Antisense; GTTGGCTCTAGAGAAGTACGACCTT
>probe:Drosophila_2:1639101_at:217:91; Interrogation_Position=552; Antisense; AGTACGACCTTCTGAACAAGCGACA
>probe:Drosophila_2:1639101_at:248:541; Interrogation_Position=640; Antisense; GGTTGTTCTGGATAACTCCACCTGA
>probe:Drosophila_2:1639101_at:81:87; Interrogation_Position=664; Antisense; AGTCGGGCTCAGATGCCTAGGACCA
>probe:Drosophila_2:1639101_at:465:71; Interrogation_Position=682; Antisense; AGGACCACCACATTAGGAACTTAGT
>probe:Drosophila_2:1639101_at:497:35; Interrogation_Position=735; Antisense; ATCATGGGTCGACACAATCGCTGCA
>probe:Drosophila_2:1639101_at:128:43; Interrogation_Position=751; Antisense; ATCGCTGCACCATGATCTACTAGAG

Paste this into a BLAST search page for me
TACTAAGGCTCCGATGACCCAGTGGGACGCATTGCTGAAGGTGACCGATAATACGCGCAGATCGGTGCAACAGCTCCTGGTTGGCAGGAGCACCGATTTGGGATCCAAACAATCTCGGAGGCATTGCATTCGAAGCCTGGAGTACGTACTGTACGTACTCCTGAAGTTGGCTCTAGTTGGCTCTAGAGAAGTACGACCTTAGTACGACCTTCTGAACAAGCGACAGGTTGTTCTGGATAACTCCACCTGAAGTCGGGCTCAGATGCCTAGGACCAAGGACCACCACATTAGGAACTTAGTATCATGGGTCGACACAATCGCTGCAATCGCTGCACCATGATCTACTAGAG

Full Affymetrix probeset data:

Annotations for 1639101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720