FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639102_at:

>probe:Drosophila_2:1639102_at:652:341; Interrogation_Position=1013; Antisense; GCTTTCTACTTACTTTATCCCTTAG
>probe:Drosophila_2:1639102_at:499:21; Interrogation_Position=1096; Antisense; ATATATATGTTCACTTTCTGGCTAA
>probe:Drosophila_2:1639102_at:481:715; Interrogation_Position=1111; Antisense; TTCTGGCTAAGTACTCGCATTTCAA
>probe:Drosophila_2:1639102_at:328:241; Interrogation_Position=639; Antisense; AATACCATCTTCGTGTCCGGCAACA
>probe:Drosophila_2:1639102_at:588:103; Interrogation_Position=688; Antisense; AGACATTCAACGACTACGGCACCAT
>probe:Drosophila_2:1639102_at:712:567; Interrogation_Position=705; Antisense; GGCACCATTGTCAATGTCTCCATGG
>probe:Drosophila_2:1639102_at:82:215; Interrogation_Position=738; Antisense; AAGAGTCGCGGCTTTGTTTCCTTCG
>probe:Drosophila_2:1639102_at:23:97; Interrogation_Position=779; Antisense; AGATCGCGCCATTGCGGAGATTCAT
>probe:Drosophila_2:1639102_at:647:719; Interrogation_Position=828; Antisense; TTGCAGGTGCAGTTGGCTAGACGCC
>probe:Drosophila_2:1639102_at:416:465; Interrogation_Position=860; Antisense; GATTGAGCCCATTAACGATGCCTCC
>probe:Drosophila_2:1639102_at:382:639; Interrogation_Position=885; Antisense; TCGTCGGCAGTCTGGTCATCTATTG
>probe:Drosophila_2:1639102_at:347:225; Interrogation_Position=939; Antisense; AAGGACCACCGCGAGATGGTTCAAT
>probe:Drosophila_2:1639102_at:310:55; Interrogation_Position=967; Antisense; ATGAAGACTTCTTGCTCTAGAGCGC
>probe:Drosophila_2:1639102_at:327:675; Interrogation_Position=998; Antisense; TAGTTTCTACGTTTAGCTTTCTACT

Paste this into a BLAST search page for me
GCTTTCTACTTACTTTATCCCTTAGATATATATGTTCACTTTCTGGCTAATTCTGGCTAAGTACTCGCATTTCAAAATACCATCTTCGTGTCCGGCAACAAGACATTCAACGACTACGGCACCATGGCACCATTGTCAATGTCTCCATGGAAGAGTCGCGGCTTTGTTTCCTTCGAGATCGCGCCATTGCGGAGATTCATTTGCAGGTGCAGTTGGCTAGACGCCGATTGAGCCCATTAACGATGCCTCCTCGTCGGCAGTCTGGTCATCTATTGAAGGACCACCGCGAGATGGTTCAATATGAAGACTTCTTGCTCTAGAGCGCTAGTTTCTACGTTTAGCTTTCTACT

Full Affymetrix probeset data:

Annotations for 1639102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720