FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639105_at:

>probe:Drosophila_2:1639105_at:336:695; Interrogation_Position=352; Antisense; TTACTGGGCTTCAAGGGTCCGGCAA
>probe:Drosophila_2:1639105_at:231:9; Interrogation_Position=379; Antisense; ATTGCCTTTGCACATTCAGCATTTG
>probe:Drosophila_2:1639105_at:487:463; Interrogation_Position=418; Antisense; GATTCCAATTCTGATTATGCCTACG
>probe:Drosophila_2:1639105_at:288:481; Interrogation_Position=446; Antisense; GTATTTTGTACGATCTGAGCACCGA
>probe:Drosophila_2:1639105_at:381:427; Interrogation_Position=472; Antisense; GAGATTACTGCCGAGGATAACCTAG
>probe:Drosophila_2:1639105_at:418:609; Interrogation_Position=518; Antisense; TGAGAAGATGCCGATTTCCCCACGA
>probe:Drosophila_2:1639105_at:312:697; Interrogation_Position=549; Antisense; TTTAACACATTTTCCCTTCTACACT
>probe:Drosophila_2:1639105_at:263:601; Interrogation_Position=628; Antisense; TGTATCCCACATTTTTATCCCAATC
>probe:Drosophila_2:1639105_at:574:173; Interrogation_Position=660; Antisense; AAACCCCAAGCCAGTGTGCGATTAT
>probe:Drosophila_2:1639105_at:576:189; Interrogation_Position=687; Antisense; AACTTTAAGATCGTGCTTTCCCCAT
>probe:Drosophila_2:1639105_at:369:341; Interrogation_Position=701; Antisense; GCTTTCCCCATCATGCAAGTTTTTT
>probe:Drosophila_2:1639105_at:257:369; Interrogation_Position=759; Antisense; GAATCCAGCTATTTGTTACTGCGAA
>probe:Drosophila_2:1639105_at:494:373; Interrogation_Position=813; Antisense; GAAGTCCATGAATCCCATGTCCGGA
>probe:Drosophila_2:1639105_at:548:21; Interrogation_Position=916; Antisense; ATATTCTCACTGACCGATCTTTTGG

Paste this into a BLAST search page for me
TTACTGGGCTTCAAGGGTCCGGCAAATTGCCTTTGCACATTCAGCATTTGGATTCCAATTCTGATTATGCCTACGGTATTTTGTACGATCTGAGCACCGAGAGATTACTGCCGAGGATAACCTAGTGAGAAGATGCCGATTTCCCCACGATTTAACACATTTTCCCTTCTACACTTGTATCCCACATTTTTATCCCAATCAAACCCCAAGCCAGTGTGCGATTATAACTTTAAGATCGTGCTTTCCCCATGCTTTCCCCATCATGCAAGTTTTTTGAATCCAGCTATTTGTTACTGCGAAGAAGTCCATGAATCCCATGTCCGGAATATTCTCACTGACCGATCTTTTGG

Full Affymetrix probeset data:

Annotations for 1639105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720