FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639106_at:

>probe:Drosophila_2:1639106_at:95:559; Interrogation_Position=3202; Antisense; GGAAAGCCCCGGGTGTTTCATGTCA
>probe:Drosophila_2:1639106_at:118:603; Interrogation_Position=3215; Antisense; TGTTTCATGTCACCCTGTACAAGGA
>probe:Drosophila_2:1639106_at:243:407; Interrogation_Position=3278; Antisense; GACTGTACGAGCGTGGCGTCTTCAT
>probe:Drosophila_2:1639106_at:470:497; Interrogation_Position=3295; Antisense; GTCTTCATCAACAGGATTCGCAGCG
>probe:Drosophila_2:1639106_at:55:25; Interrogation_Position=3332; Antisense; ATATGTGCGGCCTACTGAAGCCCTT
>probe:Drosophila_2:1639106_at:402:379; Interrogation_Position=3348; Antisense; GAAGCCCTTCGATCGGATCATGCAG
>probe:Drosophila_2:1639106_at:385:135; Interrogation_Position=3388; Antisense; ACGCAGGACTTCGATTGCTGTCTTA
>probe:Drosophila_2:1639106_at:381:425; Interrogation_Position=3448; Antisense; GAGATGATCATGCAGCGCTCTGAGT
>probe:Drosophila_2:1639106_at:631:279; Interrogation_Position=3465; Antisense; CTCTGAGTGATGCTTTTGCCCGAGA
>probe:Drosophila_2:1639106_at:33:721; Interrogation_Position=3480; Antisense; TTGCCCGAGATCCTTATGTTAAACT
>probe:Drosophila_2:1639106_at:551:619; Interrogation_Position=3512; Antisense; TGCTAAGCTAATCCTAAGTGCCATT
>probe:Drosophila_2:1639106_at:646:219; Interrogation_Position=3527; Antisense; AAGTGCCATTGCTAGCCCATAATAT
>probe:Drosophila_2:1639106_at:668:687; Interrogation_Position=3563; Antisense; TATATCCCTGTATTCTTTACCGAGC
>probe:Drosophila_2:1639106_at:270:699; Interrogation_Position=3578; Antisense; TTTACCGAGCGAAACCTGCACACAA

Paste this into a BLAST search page for me
GGAAAGCCCCGGGTGTTTCATGTCATGTTTCATGTCACCCTGTACAAGGAGACTGTACGAGCGTGGCGTCTTCATGTCTTCATCAACAGGATTCGCAGCGATATGTGCGGCCTACTGAAGCCCTTGAAGCCCTTCGATCGGATCATGCAGACGCAGGACTTCGATTGCTGTCTTAGAGATGATCATGCAGCGCTCTGAGTCTCTGAGTGATGCTTTTGCCCGAGATTGCCCGAGATCCTTATGTTAAACTTGCTAAGCTAATCCTAAGTGCCATTAAGTGCCATTGCTAGCCCATAATATTATATCCCTGTATTCTTTACCGAGCTTTACCGAGCGAAACCTGCACACAA

Full Affymetrix probeset data:

Annotations for 1639106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720