FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639108_at:

>probe:Drosophila_2:1639108_at:370:69; Interrogation_Position=112; Antisense; ATGGCCGACGAAACAGAGCAGCTCA
>probe:Drosophila_2:1639108_at:110:337; Interrogation_Position=132; Antisense; GCTCAGTCAGGTGATTTTGCCGGTA
>probe:Drosophila_2:1639108_at:220:169; Interrogation_Position=156; Antisense; AAAGGAGCCTTTGGATCTCATCCGA
>probe:Drosophila_2:1639108_at:197:517; Interrogation_Position=19; Antisense; GTGGTGCAACTTATAAACAGCGTTT
>probe:Drosophila_2:1639108_at:104:373; Interrogation_Position=195; Antisense; GAAGGTGTACGTAAAGATGCGCAAC
>probe:Drosophila_2:1639108_at:649:121; Interrogation_Position=221; Antisense; AGCGGGAACTGCGAGGACGTCTTCA
>probe:Drosophila_2:1639108_at:591:275; Interrogation_Position=241; Antisense; CTTCACGCCTTTGATCAGCATTTGA
>probe:Drosophila_2:1639108_at:622:17; Interrogation_Position=260; Antisense; ATTTGAACATGGTGCTCGGCGATGC
>probe:Drosophila_2:1639108_at:445:435; Interrogation_Position=331; Antisense; GAGGTGTACAAGACCGCCAAGCGCA
>probe:Drosophila_2:1639108_at:64:187; Interrogation_Position=34; Antisense; AACAGCGTTTTGTGTTTCGCAAAAT
>probe:Drosophila_2:1639108_at:146:353; Interrogation_Position=353; Antisense; GCACTATTCCCATGCTATTCGTTAG
>probe:Drosophila_2:1639108_at:397:441; Interrogation_Position=382; Antisense; GATGGAGTCATCCTGGTTTCGCCAC
>probe:Drosophila_2:1639108_at:665:569; Interrogation_Position=418; Antisense; GGCTAGCGGGTCTTGTTTAGCTTTA
>probe:Drosophila_2:1639108_at:158:245; Interrogation_Position=447; Antisense; AATTACCTGCATTTATACAAGCTAT

Paste this into a BLAST search page for me
ATGGCCGACGAAACAGAGCAGCTCAGCTCAGTCAGGTGATTTTGCCGGTAAAAGGAGCCTTTGGATCTCATCCGAGTGGTGCAACTTATAAACAGCGTTTGAAGGTGTACGTAAAGATGCGCAACAGCGGGAACTGCGAGGACGTCTTCACTTCACGCCTTTGATCAGCATTTGAATTTGAACATGGTGCTCGGCGATGCGAGGTGTACAAGACCGCCAAGCGCAAACAGCGTTTTGTGTTTCGCAAAATGCACTATTCCCATGCTATTCGTTAGGATGGAGTCATCCTGGTTTCGCCACGGCTAGCGGGTCTTGTTTAGCTTTAAATTACCTGCATTTATACAAGCTAT

Full Affymetrix probeset data:

Annotations for 1639108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720