FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639111_at:

>probe:Drosophila_2:1639111_at:588:387; Interrogation_Position=103; Antisense; GAAAAGTGCTTCTTCTGCGACTTCG
>probe:Drosophila_2:1639111_at:30:409; Interrogation_Position=172; Antisense; GACGAGTACGTGATCTTCAAGGACA
>probe:Drosophila_2:1639111_at:685:225; Interrogation_Position=190; Antisense; AAGGACAAGTATCCGGCAGCCAGAC
>probe:Drosophila_2:1639111_at:276:685; Interrogation_Position=220; Antisense; TATCTGGCGATTCCCAAGGAGCACT
>probe:Drosophila_2:1639111_at:324:225; Interrogation_Position=235; Antisense; AAGGAGCACTTCGACAGCCTGAAAG
>probe:Drosophila_2:1639111_at:550:323; Interrogation_Position=259; Antisense; GCGCTGAACAAATCGCACGTTGGAT
>probe:Drosophila_2:1639111_at:721:331; Interrogation_Position=27; Antisense; GCTGGCCGGTTTGGGCTTAATAGTT
>probe:Drosophila_2:1639111_at:669:57; Interrogation_Position=307; Antisense; ATGATGGAATTCCTGCGATCGCAGA
>probe:Drosophila_2:1639111_at:663:43; Interrogation_Position=324; Antisense; ATCGCAGAACGTGGATCCCAAGGAG
>probe:Drosophila_2:1639111_at:304:223; Interrogation_Position=343; Antisense; AAGGAGGCGATTGTGGGCTTCCACT
>probe:Drosophila_2:1639111_at:281:161; Interrogation_Position=440; Antisense; ACAAGATCAGCTTTATGCCCTCATT
>probe:Drosophila_2:1639111_at:22:683; Interrogation_Position=453; Antisense; TATGCCCTCATTCTGGTTCAAAAAG
>probe:Drosophila_2:1639111_at:143:219; Interrogation_Position=475; Antisense; AAGTCCAGTGATGCGATTCGGGAAT
>probe:Drosophila_2:1639111_at:214:537; Interrogation_Position=54; Antisense; GGTATCGATCTACAAATGTGCCAGT

Paste this into a BLAST search page for me
GAAAAGTGCTTCTTCTGCGACTTCGGACGAGTACGTGATCTTCAAGGACAAAGGACAAGTATCCGGCAGCCAGACTATCTGGCGATTCCCAAGGAGCACTAAGGAGCACTTCGACAGCCTGAAAGGCGCTGAACAAATCGCACGTTGGATGCTGGCCGGTTTGGGCTTAATAGTTATGATGGAATTCCTGCGATCGCAGAATCGCAGAACGTGGATCCCAAGGAGAAGGAGGCGATTGTGGGCTTCCACTACAAGATCAGCTTTATGCCCTCATTTATGCCCTCATTCTGGTTCAAAAAGAAGTCCAGTGATGCGATTCGGGAATGGTATCGATCTACAAATGTGCCAGT

Full Affymetrix probeset data:

Annotations for 1639111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720