FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639116_at:

>probe:Drosophila_2:1639116_at:1:221; Interrogation_Position=127; Antisense; AAGTGACACAGTCCGATCTTCAAGG
>probe:Drosophila_2:1639116_at:323:445; Interrogation_Position=196; Antisense; GATGCGACTCAAGCGAAATTTCCGA
>probe:Drosophila_2:1639116_at:555:583; Interrogation_Position=222; Antisense; TGGAAGTTTCCTTACAAGCGTTCGT
>probe:Drosophila_2:1639116_at:723:205; Interrogation_Position=237; Antisense; AAGCGTTCGTTCCATCCTGTTTGTG
>probe:Drosophila_2:1639116_at:482:331; Interrogation_Position=272; Antisense; GCGGCAGCTGGTAGTAGCTATCCTA
>probe:Drosophila_2:1639116_at:121:85; Interrogation_Position=353; Antisense; AGTGAACTGTCACTGCCAGACGTGC
>probe:Drosophila_2:1639116_at:523:103; Interrogation_Position=370; Antisense; AGACGTGCTCCACACAGGATACCAG
>probe:Drosophila_2:1639116_at:412:115; Interrogation_Position=432; Antisense; AGCAGGGCAATCATGGCCGCCAATT
>probe:Drosophila_2:1639116_at:220:299; Interrogation_Position=461; Antisense; CGCCAATCATTACCGAAGTGCCTAT
>probe:Drosophila_2:1639116_at:334:109; Interrogation_Position=491; Antisense; AGAAGGCCAACTCGAAGCGTCCACG
>probe:Drosophila_2:1639116_at:88:233; Interrogation_Position=540; Antisense; AATGAACTCTGGCTGTGCTTGCTGC
>probe:Drosophila_2:1639116_at:438:509; Interrogation_Position=554; Antisense; GTGCTTGCTGCAGATATCGCGAATC
>probe:Drosophila_2:1639116_at:472:23; Interrogation_Position=82; Antisense; ATATCGTGACGCCTTTGGGATGCCA
>probe:Drosophila_2:1639116_at:116:593; Interrogation_Position=97; Antisense; TGGGATGCCATCGTCGTGTATACAC

Paste this into a BLAST search page for me
AAGTGACACAGTCCGATCTTCAAGGGATGCGACTCAAGCGAAATTTCCGATGGAAGTTTCCTTACAAGCGTTCGTAAGCGTTCGTTCCATCCTGTTTGTGGCGGCAGCTGGTAGTAGCTATCCTAAGTGAACTGTCACTGCCAGACGTGCAGACGTGCTCCACACAGGATACCAGAGCAGGGCAATCATGGCCGCCAATTCGCCAATCATTACCGAAGTGCCTATAGAAGGCCAACTCGAAGCGTCCACGAATGAACTCTGGCTGTGCTTGCTGCGTGCTTGCTGCAGATATCGCGAATCATATCGTGACGCCTTTGGGATGCCATGGGATGCCATCGTCGTGTATACAC

Full Affymetrix probeset data:

Annotations for 1639116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720