Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639117_a_at:

>probe:Drosophila_2:1639117_a_at:574:407; Interrogation_Position=1007; Antisense; GACGGAGGCGTTAGCGACACTACAT
>probe:Drosophila_2:1639117_a_at:350:201; Interrogation_Position=486; Antisense; AACCTGATCACCTGCATCTATGTCA
>probe:Drosophila_2:1639117_a_at:670:367; Interrogation_Position=521; Antisense; GAATGCCAAGTACACACTTCTCTTC
>probe:Drosophila_2:1639117_a_at:645:167; Interrogation_Position=574; Antisense; AAATGAGCAGCTTCTACCTGACCCT
>probe:Drosophila_2:1639117_a_at:251:595; Interrogation_Position=598; Antisense; TGGGCTCCCAGATCAACTGCAATAT
>probe:Drosophila_2:1639117_a_at:276:21; Interrogation_Position=619; Antisense; ATATCTTTGGGTACGACTACTCCGG
>probe:Drosophila_2:1639117_a_at:442:51; Interrogation_Position=685; Antisense; ATGCGGACATCGAGGCTGCCTGGCA
>probe:Drosophila_2:1639117_a_at:113:109; Interrogation_Position=717; Antisense; AGAACCAGATTCAACATCAGCCCGG
>probe:Drosophila_2:1639117_a_at:293:35; Interrogation_Position=732; Antisense; ATCAGCCCGGAGACAATCATCTTGT
>probe:Drosophila_2:1639117_a_at:674:433; Interrogation_Position=807; Antisense; GAGGTCGGCGCTGTGATACTCCATT
>probe:Drosophila_2:1639117_a_at:401:439; Interrogation_Position=839; Antisense; GATGTCCGGCCTAAGGGTCGTCTTT
>probe:Drosophila_2:1639117_a_at:447:421; Interrogation_Position=875; Antisense; GAGAACCTGGTTCTTCGACGCCTTT
>probe:Drosophila_2:1639117_a_at:188:519; Interrogation_Position=923; Antisense; GTGGAACTGCATCCGCATTATTACG
>probe:Drosophila_2:1639117_a_at:434:405; Interrogation_Position=951; Antisense; GACTGCGCAAATTTCTTTCGGTGGA

Paste this into a BLAST search page for me
GACGGAGGCGTTAGCGACACTACATAACCTGATCACCTGCATCTATGTCAGAATGCCAAGTACACACTTCTCTTCAAATGAGCAGCTTCTACCTGACCCTTGGGCTCCCAGATCAACTGCAATATATATCTTTGGGTACGACTACTCCGGATGCGGACATCGAGGCTGCCTGGCAAGAACCAGATTCAACATCAGCCCGGATCAGCCCGGAGACAATCATCTTGTGAGGTCGGCGCTGTGATACTCCATTGATGTCCGGCCTAAGGGTCGTCTTTGAGAACCTGGTTCTTCGACGCCTTTGTGGAACTGCATCCGCATTATTACGGACTGCGCAAATTTCTTTCGGTGGA

Full Affymetrix probeset data:

Annotations for 1639117_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime