Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639120_at:

>probe:Drosophila_2:1639120_at:150:455; Interrogation_Position=1007; Antisense; GATCACCTTCGTTGTCATCCGTCAA
>probe:Drosophila_2:1639120_at:611:269; Interrogation_Position=1022; Antisense; CATCCGTCAACGTATAAGGTCTGTG
>probe:Drosophila_2:1639120_at:434:689; Interrogation_Position=1082; Antisense; TATTTTTTCTATGTGCTGGTTCAAG
>probe:Drosophila_2:1639120_at:685:359; Interrogation_Position=557; Antisense; GCAACTCCTTGACTTTATCAGAAAA
>probe:Drosophila_2:1639120_at:387:183; Interrogation_Position=580; Antisense; AACAAGGCCAATAGATCCCTCGGAA
>probe:Drosophila_2:1639120_at:643:301; Interrogation_Position=596; Antisense; CCCTCGGAAAATTGGCTAAGCTCTT
>probe:Drosophila_2:1639120_at:402:35; Interrogation_Position=638; Antisense; ATCAGCGATTAGTCCGAGAAGTTTT
>probe:Drosophila_2:1639120_at:529:699; Interrogation_Position=659; Antisense; TTTTTCGAACCTTTGACTTGCCCAT
>probe:Drosophila_2:1639120_at:47:271; Interrogation_Position=681; Antisense; CATCGCCCTTCTTTTGCTGAAAATG
>probe:Drosophila_2:1639120_at:111:557; Interrogation_Position=790; Antisense; GGACAGTGGGTGGTGATTTCTCATT
>probe:Drosophila_2:1639120_at:362:143; Interrogation_Position=815; Antisense; ACTGGAGTGCTGTTTTGCTCATGAA
>probe:Drosophila_2:1639120_at:164:529; Interrogation_Position=879; Antisense; GGGAGACCTCCTGCGAGAATTCAGT
>probe:Drosophila_2:1639120_at:201:75; Interrogation_Position=922; Antisense; AGGGACTTTCATTTGCAGGTAGCAT
>probe:Drosophila_2:1639120_at:101:675; Interrogation_Position=989; Antisense; TAGCTGGAACTTTTCTCGGATCACC

Paste this into a BLAST search page for me
GATCACCTTCGTTGTCATCCGTCAACATCCGTCAACGTATAAGGTCTGTGTATTTTTTCTATGTGCTGGTTCAAGGCAACTCCTTGACTTTATCAGAAAAAACAAGGCCAATAGATCCCTCGGAACCCTCGGAAAATTGGCTAAGCTCTTATCAGCGATTAGTCCGAGAAGTTTTTTTTTCGAACCTTTGACTTGCCCATCATCGCCCTTCTTTTGCTGAAAATGGGACAGTGGGTGGTGATTTCTCATTACTGGAGTGCTGTTTTGCTCATGAAGGGAGACCTCCTGCGAGAATTCAGTAGGGACTTTCATTTGCAGGTAGCATTAGCTGGAACTTTTCTCGGATCACC

Full Affymetrix probeset data:

Annotations for 1639120_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime