FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639121_at:

>probe:Drosophila_2:1639121_at:170:573; Interrogation_Position=1002; Antisense; GGCGGATCAACGCTCTTCAAAGGAT
>probe:Drosophila_2:1639121_at:222:339; Interrogation_Position=1013; Antisense; GCTCTTCAAAGGATTCGGCGACCGT
>probe:Drosophila_2:1639121_at:53:413; Interrogation_Position=1032; Antisense; GACCGTCTGTTGTCCGAACTGAAGA
>probe:Drosophila_2:1639121_at:44:391; Interrogation_Position=1055; Antisense; GAAACACTCGGCTAAGGATCTCAAG
>probe:Drosophila_2:1639121_at:496:653; Interrogation_Position=1075; Antisense; TCAAGATCAGGATCGCTGCGCCGCA
>probe:Drosophila_2:1639121_at:618:73; Interrogation_Position=1099; Antisense; AGGAACGTCTGTACTCCACATGGAT
>probe:Drosophila_2:1639121_at:78:63; Interrogation_Position=1122; Antisense; ATGGGCGGATCGATTTTAGCCTCGC
>probe:Drosophila_2:1639121_at:659:125; Interrogation_Position=1139; Antisense; AGCCTCGCTCGATACTTTCAAGAAG
>probe:Drosophila_2:1639121_at:27:167; Interrogation_Position=1282; Antisense; AAATCCTTGTGTCAGCTAACATGAA
>probe:Drosophila_2:1639121_at:634:689; Interrogation_Position=1379; Antisense; TATTGAAACTGCTTTCCCAGCCTAG
>probe:Drosophila_2:1639121_at:213:621; Interrogation_Position=1434; Antisense; TGCGGATAATTCCTTCCCAGGTTAA
>probe:Drosophila_2:1639121_at:267:13; Interrogation_Position=921; Antisense; ATTCACGACGTTCTGATGTACTCCA
>probe:Drosophila_2:1639121_at:83:167; Interrogation_Position=973; Antisense; AAATGCTCTACCAGAACATCGTGCT
>probe:Drosophila_2:1639121_at:485:189; Interrogation_Position=987; Antisense; AACATCGTGCTGTCCGGCGGATCAA

Paste this into a BLAST search page for me
GGCGGATCAACGCTCTTCAAAGGATGCTCTTCAAAGGATTCGGCGACCGTGACCGTCTGTTGTCCGAACTGAAGAGAAACACTCGGCTAAGGATCTCAAGTCAAGATCAGGATCGCTGCGCCGCAAGGAACGTCTGTACTCCACATGGATATGGGCGGATCGATTTTAGCCTCGCAGCCTCGCTCGATACTTTCAAGAAGAAATCCTTGTGTCAGCTAACATGAATATTGAAACTGCTTTCCCAGCCTAGTGCGGATAATTCCTTCCCAGGTTAAATTCACGACGTTCTGATGTACTCCAAAATGCTCTACCAGAACATCGTGCTAACATCGTGCTGTCCGGCGGATCAA

Full Affymetrix probeset data:

Annotations for 1639121_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720