FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639123_at:

>probe:Drosophila_2:1639123_at:418:725; Interrogation_Position=1100; Antisense; TTGAGGCAGCGGTGCAGCGACAACT
>probe:Drosophila_2:1639123_at:201:415; Interrogation_Position=1144; Antisense; GAGCGTAAGGCCACCATCCAGAAGA
>probe:Drosophila_2:1639123_at:445:471; Interrogation_Position=1206; Antisense; GTTCTTCGAGAACCGGGACGACATC
>probe:Drosophila_2:1639123_at:257:527; Interrogation_Position=1220; Antisense; GGGACGACATCGACATCCAGATCTA
>probe:Drosophila_2:1639123_at:458:375; Interrogation_Position=1248; Antisense; GAAGAAGGTCTACTATCCCAAGCGC
>probe:Drosophila_2:1639123_at:696:45; Interrogation_Position=1262; Antisense; ATCCCAAGCGCTGGTTCGGCAAAAA
>probe:Drosophila_2:1639123_at:391:251; Interrogation_Position=1296; Antisense; CAAGGCAGCAGACACCTTCTATGTG
>probe:Drosophila_2:1639123_at:729:403; Interrogation_Position=1326; Antisense; GACTATCACGCACAACGGCTAGTGG
>probe:Drosophila_2:1639123_at:239:571; Interrogation_Position=1342; Antisense; GGCTAGTGGACAACCCGTGGACCCA
>probe:Drosophila_2:1639123_at:551:193; Interrogation_Position=865; Antisense; AACTCAGCTGCCCTGCACAAGGAGA
>probe:Drosophila_2:1639123_at:260:225; Interrogation_Position=883; Antisense; AAGGAGACTCTTTTAGCCGCACAGA
>probe:Drosophila_2:1639123_at:524:447; Interrogation_Position=935; Antisense; GATCCGAAGAGCTGCTGAAGTCCCT
>probe:Drosophila_2:1639123_at:635:219; Interrogation_Position=952; Antisense; AAGTCCCTGCAGGAAGCCGTTGAGA
>probe:Drosophila_2:1639123_at:120:369; Interrogation_Position=990; Antisense; GAATGCCATTCAATCGCTACTGGAG

Paste this into a BLAST search page for me
TTGAGGCAGCGGTGCAGCGACAACTGAGCGTAAGGCCACCATCCAGAAGAGTTCTTCGAGAACCGGGACGACATCGGGACGACATCGACATCCAGATCTAGAAGAAGGTCTACTATCCCAAGCGCATCCCAAGCGCTGGTTCGGCAAAAACAAGGCAGCAGACACCTTCTATGTGGACTATCACGCACAACGGCTAGTGGGGCTAGTGGACAACCCGTGGACCCAAACTCAGCTGCCCTGCACAAGGAGAAAGGAGACTCTTTTAGCCGCACAGAGATCCGAAGAGCTGCTGAAGTCCCTAAGTCCCTGCAGGAAGCCGTTGAGAGAATGCCATTCAATCGCTACTGGAG

Full Affymetrix probeset data:

Annotations for 1639123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720