FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639126_at:

>probe:Drosophila_2:1639126_at:35:693; Interrogation_Position=1066; Antisense; TTTGGTGAACTACATCTGCCGGAGA
>probe:Drosophila_2:1639126_at:574:77; Interrogation_Position=1098; Antisense; AGGTAGTTCCATAATGCCCGGCAAA
>probe:Drosophila_2:1639126_at:347:697; Interrogation_Position=1216; Antisense; TTTCAGCTGAACACCTTTATGCCCA
>probe:Drosophila_2:1639126_at:640:699; Interrogation_Position=1231; Antisense; TTTATGCCCATGATTGCCTCCAATG
>probe:Drosophila_2:1639126_at:365:281; Interrogation_Position=1248; Antisense; CTCCAATGTTTTGCGCTCGATTACA
>probe:Drosophila_2:1639126_at:252:441; Interrogation_Position=1282; Antisense; GATGGCATGAAGTCCTTTTGCACCA
>probe:Drosophila_2:1639126_at:331:701; Interrogation_Position=1297; Antisense; TTTTGCACCAATTGCCTCGAGGGCA
>probe:Drosophila_2:1639126_at:653:585; Interrogation_Position=1344; Antisense; TGGTAGCATCGTCAAGGAGTCCCTG
>probe:Drosophila_2:1639126_at:446:223; Interrogation_Position=1357; Antisense; AAGGAGTCCCTGATGCTGGTCACTG
>probe:Drosophila_2:1639126_at:652:3; Interrogation_Position=1396; Antisense; ATTGGCTACGAACGATCCGCTGCGA
>probe:Drosophila_2:1639126_at:551:353; Interrogation_Position=1429; Antisense; GCAGCGCATCACAATGGAACCACTT
>probe:Drosophila_2:1639126_at:330:607; Interrogation_Position=1473; Antisense; TGATGGCATTCAACGGGAGGACTTC
>probe:Drosophila_2:1639126_at:317:623; Interrogation_Position=961; Antisense; TGCGATTGCCTGGTGGAACTGCACG
>probe:Drosophila_2:1639126_at:154:383; Interrogation_Position=976; Antisense; GAACTGCACGGTGAACTCAACACGA

Paste this into a BLAST search page for me
TTTGGTGAACTACATCTGCCGGAGAAGGTAGTTCCATAATGCCCGGCAAATTTCAGCTGAACACCTTTATGCCCATTTATGCCCATGATTGCCTCCAATGCTCCAATGTTTTGCGCTCGATTACAGATGGCATGAAGTCCTTTTGCACCATTTTGCACCAATTGCCTCGAGGGCATGGTAGCATCGTCAAGGAGTCCCTGAAGGAGTCCCTGATGCTGGTCACTGATTGGCTACGAACGATCCGCTGCGAGCAGCGCATCACAATGGAACCACTTTGATGGCATTCAACGGGAGGACTTCTGCGATTGCCTGGTGGAACTGCACGGAACTGCACGGTGAACTCAACACGA

Full Affymetrix probeset data:

Annotations for 1639126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720