FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639128_at:

>probe:Drosophila_2:1639128_at:473:273; Interrogation_Position=183; Antisense; CATTTCGTGGATCATACTGTCGGCA
>probe:Drosophila_2:1639128_at:518:567; Interrogation_Position=204; Antisense; GGCACTCGCTGTGAGGGTCTACAAG
>probe:Drosophila_2:1639128_at:399:15; Interrogation_Position=261; Antisense; ATTAGCTTTCATCATTCTCTCAGTG
>probe:Drosophila_2:1639128_at:301:265; Interrogation_Position=301; Antisense; CAGACTCCAGCATTGACCTTGTTAT
>probe:Drosophila_2:1639128_at:488:647; Interrogation_Position=359; Antisense; TCACCCTGTTCGGAGCGTATTATAT
>probe:Drosophila_2:1639128_at:652:681; Interrogation_Position=379; Antisense; TATATGCATCTAGTGCGCGTCTGGG
>probe:Drosophila_2:1639128_at:201:465; Interrogation_Position=411; Antisense; GATTGCCATTTTGGTTGCCGGATCC
>probe:Drosophila_2:1639128_at:105:473; Interrogation_Position=478; Antisense; GTTCTGCTACCCAACATTATCTGTA
>probe:Drosophila_2:1639128_at:345:231; Interrogation_Position=568; Antisense; AATGATATGCGGTATCTCCTGGCAC
>probe:Drosophila_2:1639128_at:462:721; Interrogation_Position=593; Antisense; TTGCCATAGTGTTCGTCATCCTGAT
>probe:Drosophila_2:1639128_at:688:17; Interrogation_Position=633; Antisense; ATTTCAGGCTCGTTTCATTTGTGGA
>probe:Drosophila_2:1639128_at:242:425; Interrogation_Position=682; Antisense; GAGACTGCGGATTGCGCCAATGGCA
>probe:Drosophila_2:1639128_at:268:149; Interrogation_Position=716; Antisense; ACTTTATTTTTCTACTCTCCTGCAT
>probe:Drosophila_2:1639128_at:402:39; Interrogation_Position=739; Antisense; ATGCTCGTTTTTGCCCTGTACTATA

Paste this into a BLAST search page for me
CATTTCGTGGATCATACTGTCGGCAGGCACTCGCTGTGAGGGTCTACAAGATTAGCTTTCATCATTCTCTCAGTGCAGACTCCAGCATTGACCTTGTTATTCACCCTGTTCGGAGCGTATTATATTATATGCATCTAGTGCGCGTCTGGGGATTGCCATTTTGGTTGCCGGATCCGTTCTGCTACCCAACATTATCTGTAAATGATATGCGGTATCTCCTGGCACTTGCCATAGTGTTCGTCATCCTGATATTTCAGGCTCGTTTCATTTGTGGAGAGACTGCGGATTGCGCCAATGGCAACTTTATTTTTCTACTCTCCTGCATATGCTCGTTTTTGCCCTGTACTATA

Full Affymetrix probeset data:

Annotations for 1639128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720