FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639129_at:

>probe:Drosophila_2:1639129_at:54:211; Interrogation_Position=1066; Antisense; AAGAATCCCTTCATCACTGTTATAG
>probe:Drosophila_2:1639129_at:357:561; Interrogation_Position=1108; Antisense; GGAAAATGCGTGTACCTCATCTACC
>probe:Drosophila_2:1639129_at:315:531; Interrogation_Position=1194; Antisense; GGTGGCCGATGATAATCTTCTCTAC
>probe:Drosophila_2:1639129_at:667:389; Interrogation_Position=1219; Antisense; GAAATTGTTAACCACCTATCGCTAA
>probe:Drosophila_2:1639129_at:660:339; Interrogation_Position=1239; Antisense; GCTAAAATTGCTCAACCACTCGGTG
>probe:Drosophila_2:1639129_at:172:571; Interrogation_Position=1279; Antisense; GGCTTCTTTACCCTGGACATGGAAA
>probe:Drosophila_2:1639129_at:57:523; Interrogation_Position=1319; Antisense; GTGGCGGGATCACTAGCTACCTGAT
>probe:Drosophila_2:1639129_at:236:605; Interrogation_Position=1349; Antisense; TGATTCAGTTCAATTTGGCCGCCCA
>probe:Drosophila_2:1639129_at:217:571; Interrogation_Position=1386; Antisense; GGCTATACAGACGTTCAACTCGCTT
>probe:Drosophila_2:1639129_at:640:727; Interrogation_Position=1430; Antisense; TTGGTGCCGCCACCGATATGGATAA
>probe:Drosophila_2:1639129_at:667:381; Interrogation_Position=939; Antisense; GAACGAGCTGTGGAGCTATCCCATT
>probe:Drosophila_2:1639129_at:554:711; Interrogation_Position=962; Antisense; TTCTATCTCTAATGGCCTATGGTTT
>probe:Drosophila_2:1639129_at:196:591; Interrogation_Position=981; Antisense; TGGTTTTCTGATTTTCACTGCTCAA
>probe:Drosophila_2:1639129_at:566:143; Interrogation_Position=997; Antisense; ACTGCTCAACTTTATTTCCTCTACT

Paste this into a BLAST search page for me
AAGAATCCCTTCATCACTGTTATAGGGAAAATGCGTGTACCTCATCTACCGGTGGCCGATGATAATCTTCTCTACGAAATTGTTAACCACCTATCGCTAAGCTAAAATTGCTCAACCACTCGGTGGGCTTCTTTACCCTGGACATGGAAAGTGGCGGGATCACTAGCTACCTGATTGATTCAGTTCAATTTGGCCGCCCAGGCTATACAGACGTTCAACTCGCTTTTGGTGCCGCCACCGATATGGATAAGAACGAGCTGTGGAGCTATCCCATTTTCTATCTCTAATGGCCTATGGTTTTGGTTTTCTGATTTTCACTGCTCAAACTGCTCAACTTTATTTCCTCTACT

Full Affymetrix probeset data:

Annotations for 1639129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720