FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639133_at:

>probe:Drosophila_2:1639133_at:419:207; Interrogation_Position=344; Antisense; AAGCTGAACAAGATCACCCATCCGA
>probe:Drosophila_2:1639133_at:624:307; Interrogation_Position=369; Antisense; CCATCCATCGCAAGATCTTTTGGCA
>probe:Drosophila_2:1639133_at:324:361; Interrogation_Position=391; Antisense; GCAAGTGTGCAAGCTGCTGGTCACG
>probe:Drosophila_2:1639133_at:320:131; Interrogation_Position=458; Antisense; ACCGGCGTGCTGATGGACTTTATAC
>probe:Drosophila_2:1639133_at:170:215; Interrogation_Position=485; Antisense; AAGATCGTCTGTGTAACCTGCGACT
>probe:Drosophila_2:1639133_at:604:241; Interrogation_Position=532; Antisense; AATAGCCCGCAATGAGCTCTCGGAA
>probe:Drosophila_2:1639133_at:594:637; Interrogation_Position=576; Antisense; TCGATTCACAAATGCCGCTGGACAA
>probe:Drosophila_2:1639133_at:357:373; Interrogation_Position=610; Antisense; GAAGTCTCACTTCGTCATTGACAAT
>probe:Drosophila_2:1639133_at:692:279; Interrogation_Position=661; Antisense; CTCGGCCATGAGCATTTACAACCTG
>probe:Drosophila_2:1639133_at:158:709; Interrogation_Position=676; Antisense; TTACAACCTGATGCGCGACTCCAAG
>probe:Drosophila_2:1639133_at:605:601; Interrogation_Position=735; Antisense; TGTTCCTAATCGTGGGCTTCACAAT
>probe:Drosophila_2:1639133_at:480:47; Interrogation_Position=764; Antisense; ATGCTGCTGAAGGTGTTCAACCGGC
>probe:Drosophila_2:1639133_at:580:87; Interrogation_Position=795; Antisense; AGTCCTGGCAGATGTAGTCCGTGTC
>probe:Drosophila_2:1639133_at:575:507; Interrogation_Position=821; Antisense; GTGCGTGCCATACGAGGTCACTTTA

Paste this into a BLAST search page for me
AAGCTGAACAAGATCACCCATCCGACCATCCATCGCAAGATCTTTTGGCAGCAAGTGTGCAAGCTGCTGGTCACGACCGGCGTGCTGATGGACTTTATACAAGATCGTCTGTGTAACCTGCGACTAATAGCCCGCAATGAGCTCTCGGAATCGATTCACAAATGCCGCTGGACAAGAAGTCTCACTTCGTCATTGACAATCTCGGCCATGAGCATTTACAACCTGTTACAACCTGATGCGCGACTCCAAGTGTTCCTAATCGTGGGCTTCACAATATGCTGCTGAAGGTGTTCAACCGGCAGTCCTGGCAGATGTAGTCCGTGTCGTGCGTGCCATACGAGGTCACTTTA

Full Affymetrix probeset data:

Annotations for 1639133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720