FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639135_at:

>probe:Drosophila_2:1639135_at:590:439; Interrogation_Position=1582; Antisense; GAGGCCATCAAGTTTGCCCACGATA
>probe:Drosophila_2:1639135_at:497:469; Interrogation_Position=1670; Antisense; GTTCCCTGTCCAAGCTAATCAAAGT
>probe:Drosophila_2:1639135_at:714:157; Interrogation_Position=1697; Antisense; ACAATCCGGATCTGGTGCTATTCGT
>probe:Drosophila_2:1639135_at:668:413; Interrogation_Position=1753; Antisense; GACCAGCTGGTCAAGTTCAATCAGT
>probe:Drosophila_2:1639135_at:210:581; Interrogation_Position=1781; Antisense; TGGCCGACTACTCATCCAACGAGAA
>probe:Drosophila_2:1639135_at:345:35; Interrogation_Position=1813; Antisense; ATCATCGACGGCATAGTGTTGACCA
>probe:Drosophila_2:1639135_at:271:85; Interrogation_Position=1827; Antisense; AGTGTTGACCAAGTTCGATACCATC
>probe:Drosophila_2:1639135_at:501:43; Interrogation_Position=1849; Antisense; ATCGATGACAAGGTGGGCGCCGCCA
>probe:Drosophila_2:1639135_at:682:201; Interrogation_Position=1890; Antisense; AACCGGCCAGCCAATTGTGTTCGTG
>probe:Drosophila_2:1639135_at:281:141; Interrogation_Position=1918; Antisense; ACGGGTCAGACGTATGCCGACCTAA
>probe:Drosophila_2:1639135_at:719:313; Interrogation_Position=1945; Antisense; GCCATCAATGTGAACGCCGTGGTCA
>probe:Drosophila_2:1639135_at:111:319; Interrogation_Position=1960; Antisense; GCCGTGGTCAATTCCCTGATGAAGT
>probe:Drosophila_2:1639135_at:385:443; Interrogation_Position=1977; Antisense; GATGAAGTAAGCCAGCCGTCGATCC
>probe:Drosophila_2:1639135_at:609:47; Interrogation_Position=2030; Antisense; ATCCACTCTTTTCACCGAATCAAAT

Paste this into a BLAST search page for me
GAGGCCATCAAGTTTGCCCACGATAGTTCCCTGTCCAAGCTAATCAAAGTACAATCCGGATCTGGTGCTATTCGTGACCAGCTGGTCAAGTTCAATCAGTTGGCCGACTACTCATCCAACGAGAAATCATCGACGGCATAGTGTTGACCAAGTGTTGACCAAGTTCGATACCATCATCGATGACAAGGTGGGCGCCGCCAAACCGGCCAGCCAATTGTGTTCGTGACGGGTCAGACGTATGCCGACCTAAGCCATCAATGTGAACGCCGTGGTCAGCCGTGGTCAATTCCCTGATGAAGTGATGAAGTAAGCCAGCCGTCGATCCATCCACTCTTTTCACCGAATCAAAT

Full Affymetrix probeset data:

Annotations for 1639135_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720