Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639140_at:

>probe:Drosophila_2:1639140_at:241:171; Interrogation_Position=1991; Antisense; AAAGATCCGAGTGCGTAAGCCCACT
>probe:Drosophila_2:1639140_at:659:205; Interrogation_Position=2007; Antisense; AAGCCCACTGGCGATTTTCTGGAGC
>probe:Drosophila_2:1639140_at:729:585; Interrogation_Position=2026; Antisense; TGGAGCGCCGTTTTTTCATCAACAA
>probe:Drosophila_2:1639140_at:507:159; Interrogation_Position=2050; Antisense; ACAACCTACAGGATCTGCTCAACTT
>probe:Drosophila_2:1639140_at:169:283; Interrogation_Position=2064; Antisense; CTGCTCAACTTTGTGACGGCCAATG
>probe:Drosophila_2:1639140_at:532:407; Interrogation_Position=2078; Antisense; GACGGCCAATGGTTTCCTCATCGAG
>probe:Drosophila_2:1639140_at:729:207; Interrogation_Position=2109; Antisense; AAGCTAATCAGCAGCTGGCCGCGTC
>probe:Drosophila_2:1639140_at:395:501; Interrogation_Position=2131; Antisense; GTCGCGATCTTACGGCCATCGAGAG
>probe:Drosophila_2:1639140_at:434:3; Interrogation_Position=2165; Antisense; ATTGGAGTCGCTCAAGCTGTATCCG
>probe:Drosophila_2:1639140_at:577:599; Interrogation_Position=2182; Antisense; TGTATCCGCAGGAAACGGTCATCCT
>probe:Drosophila_2:1639140_at:501:461; Interrogation_Position=2218; Antisense; GATTCCGCTTGTTACTTTAAGGCCG
>probe:Drosophila_2:1639140_at:509:453; Interrogation_Position=2391; Antisense; GATAATTTCTAGCTGCAAGGTTTTA
>probe:Drosophila_2:1639140_at:446:31; Interrogation_Position=2439; Antisense; ATAATCCAACGCAATCCGATCGATC
>probe:Drosophila_2:1639140_at:361:129; Interrogation_Position=2471; Antisense; ACCAGCACCAGATACTACCGGTAAA

Paste this into a BLAST search page for me
AAAGATCCGAGTGCGTAAGCCCACTAAGCCCACTGGCGATTTTCTGGAGCTGGAGCGCCGTTTTTTCATCAACAAACAACCTACAGGATCTGCTCAACTTCTGCTCAACTTTGTGACGGCCAATGGACGGCCAATGGTTTCCTCATCGAGAAGCTAATCAGCAGCTGGCCGCGTCGTCGCGATCTTACGGCCATCGAGAGATTGGAGTCGCTCAAGCTGTATCCGTGTATCCGCAGGAAACGGTCATCCTGATTCCGCTTGTTACTTTAAGGCCGGATAATTTCTAGCTGCAAGGTTTTAATAATCCAACGCAATCCGATCGATCACCAGCACCAGATACTACCGGTAAA

Full Affymetrix probeset data:

Annotations for 1639140_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime