Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639142_s_at:

>probe:Drosophila_2:1639142_s_at:371:421; Interrogation_Position=179; Antisense; GAGCAATTCACTTTGACAGCCTGGC
>probe:Drosophila_2:1639142_s_at:14:127; Interrogation_Position=196; Antisense; AGCCTGGCAGCTGTGACCCAAAGAG
>probe:Drosophila_2:1639142_s_at:652:649; Interrogation_Position=223; Antisense; TCACTTTGAGACTTCTTGGGACCAA
>probe:Drosophila_2:1639142_s_at:639:725; Interrogation_Position=238; Antisense; TTGGGACCAACCAGCATGGGAAGTT
>probe:Drosophila_2:1639142_s_at:630:369; Interrogation_Position=302; Antisense; GAATGGTTTCCACACTTATAATGCA
>probe:Drosophila_2:1639142_s_at:173:443; Interrogation_Position=335; Antisense; GATGTTTCTGACTGAAAACCGACGA
>probe:Drosophila_2:1639142_s_at:27:369; Interrogation_Position=362; Antisense; GAATGATTTCCACACTTGTAAGTAT
>probe:Drosophila_2:1639142_s_at:560:23; Interrogation_Position=434; Antisense; ATAGGGACGTCTGATATCTGTGACT
>probe:Drosophila_2:1639142_s_at:500:39; Interrogation_Position=449; Antisense; ATCTGTGACTGATTTATCTCGATAG
>probe:Drosophila_2:1639142_s_at:199:475; Interrogation_Position=496; Antisense; GTTAGCTTGCGTGATTTTATGTTCA
>probe:Drosophila_2:1639142_s_at:607:283; Interrogation_Position=556; Antisense; CTGAAACCCGAATTTCTCTGACAGA
>probe:Drosophila_2:1639142_s_at:406:713; Interrogation_Position=569; Antisense; TTCTCTGACAGAAACCCTACGTAAG
>probe:Drosophila_2:1639142_s_at:699:209; Interrogation_Position=591; Antisense; AAGAAGGATTTCCACACTTGGCTCC
>probe:Drosophila_2:1639142_s_at:227:573; Interrogation_Position=610; Antisense; GGCTCCCTTGCATGATGCCAGAAAA

Paste this into a BLAST search page for me
GAGCAATTCACTTTGACAGCCTGGCAGCCTGGCAGCTGTGACCCAAAGAGTCACTTTGAGACTTCTTGGGACCAATTGGGACCAACCAGCATGGGAAGTTGAATGGTTTCCACACTTATAATGCAGATGTTTCTGACTGAAAACCGACGAGAATGATTTCCACACTTGTAAGTATATAGGGACGTCTGATATCTGTGACTATCTGTGACTGATTTATCTCGATAGGTTAGCTTGCGTGATTTTATGTTCACTGAAACCCGAATTTCTCTGACAGATTCTCTGACAGAAACCCTACGTAAGAAGAAGGATTTCCACACTTGGCTCCGGCTCCCTTGCATGATGCCAGAAAA

Full Affymetrix probeset data:

Annotations for 1639142_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime