FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639143_at:

>probe:Drosophila_2:1639143_at:419:113; Interrogation_Position=450; Antisense; AGCAGTGCATCCAGGAGCAGTTCAC
>probe:Drosophila_2:1639143_at:401:473; Interrogation_Position=469; Antisense; GTTCACCTGCAGTCGGTCGGGACAA
>probe:Drosophila_2:1639143_at:589:295; Interrogation_Position=511; Antisense; CGACAATCGGTACTTCTACGTCTGC
>probe:Drosophila_2:1639143_at:700:621; Interrogation_Position=533; Antisense; TGCGTCAATGACACGGCCAATTCGC
>probe:Drosophila_2:1639143_at:273:247; Interrogation_Position=551; Antisense; AATTCGCTGTATCCGCTGATGATGA
>probe:Drosophila_2:1639143_at:328:419; Interrogation_Position=637; Antisense; GAGCATTCAGGCGATGGAGTCCCAC
>probe:Drosophila_2:1639143_at:380:587; Interrogation_Position=651; Antisense; TGGAGTCCCACACGTGCATGAACAA
>probe:Drosophila_2:1639143_at:240:381; Interrogation_Position=699; Antisense; GAACCTCTGAGATCGAGTACTGCAA
>probe:Drosophila_2:1639143_at:726:317; Interrogation_Position=761; Antisense; GCCGGCTTCCAAATTGATCCTAAGA
>probe:Drosophila_2:1639143_at:304:215; Interrogation_Position=782; Antisense; AAGATCCTGACCTGCGTGACTGATA
>probe:Drosophila_2:1639143_at:16:545; Interrogation_Position=807; Antisense; GGATCTATCAGTGCTCGGACTTTGA
>probe:Drosophila_2:1639143_at:582:725; Interrogation_Position=828; Antisense; TTGAGATCCTCAGCTGTCCCAATGT
>probe:Drosophila_2:1639143_at:375:619; Interrogation_Position=872; Antisense; TGCATATGCATCGATCACCAGCTGC
>probe:Drosophila_2:1639143_at:720:349; Interrogation_Position=895; Antisense; GCAGATCTACAGCTGTCCAATGGGA

Paste this into a BLAST search page for me
AGCAGTGCATCCAGGAGCAGTTCACGTTCACCTGCAGTCGGTCGGGACAACGACAATCGGTACTTCTACGTCTGCTGCGTCAATGACACGGCCAATTCGCAATTCGCTGTATCCGCTGATGATGAGAGCATTCAGGCGATGGAGTCCCACTGGAGTCCCACACGTGCATGAACAAGAACCTCTGAGATCGAGTACTGCAAGCCGGCTTCCAAATTGATCCTAAGAAAGATCCTGACCTGCGTGACTGATAGGATCTATCAGTGCTCGGACTTTGATTGAGATCCTCAGCTGTCCCAATGTTGCATATGCATCGATCACCAGCTGCGCAGATCTACAGCTGTCCAATGGGA

Full Affymetrix probeset data:

Annotations for 1639143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720