FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639148_at:

>probe:Drosophila_2:1639148_at:389:433; Interrogation_Position=1032; Antisense; GAGTGTTGCACATTTTTTAGGCTAA
>probe:Drosophila_2:1639148_at:342:669; Interrogation_Position=1094; Antisense; TACGGCGGTCGCTAATGGTTATCAC
>probe:Drosophila_2:1639148_at:314:657; Interrogation_Position=1106; Antisense; TAATGGTTATCACCTCTCTCTTCAA
>probe:Drosophila_2:1639148_at:452:29; Interrogation_Position=1185; Antisense; ATACAATGCCTCGAAATACACCTAG
>probe:Drosophila_2:1639148_at:472:369; Interrogation_Position=679; Antisense; GAAGTACCCCAAGTACCTCGAGGAG
>probe:Drosophila_2:1639148_at:200:251; Interrogation_Position=712; Antisense; CAAGCTCTCCGCTGAGGACAAGGAA
>probe:Drosophila_2:1639148_at:413:109; Interrogation_Position=792; Antisense; AGAAGACCGAGGATTCGGCCGCCGT
>probe:Drosophila_2:1639148_at:365:7; Interrogation_Position=804; Antisense; ATTCGGCCGCCGTGAAGCGAGAGAA
>probe:Drosophila_2:1639148_at:303:121; Interrogation_Position=819; Antisense; AGCGAGAGAAGTTCCGCGTCGTGCT
>probe:Drosophila_2:1639148_at:282:637; Interrogation_Position=837; Antisense; TCGTGCTGGACGACATGCGCAAACT
>probe:Drosophila_2:1639148_at:456:321; Interrogation_Position=853; Antisense; GCGCAAACTGCAAGACTACGGCCAG
>probe:Drosophila_2:1639148_at:463:85; Interrogation_Position=966; Antisense; AGTGCCCAACCATGTAGTGGCTGAC
>probe:Drosophila_2:1639148_at:81:521; Interrogation_Position=982; Antisense; GTGGCTGACGGAGCACGATAGTCTC
>probe:Drosophila_2:1639148_at:436:137; Interrogation_Position=996; Antisense; ACGATAGTCTCGTGGTGTGCCAATT

Paste this into a BLAST search page for me
GAGTGTTGCACATTTTTTAGGCTAATACGGCGGTCGCTAATGGTTATCACTAATGGTTATCACCTCTCTCTTCAAATACAATGCCTCGAAATACACCTAGGAAGTACCCCAAGTACCTCGAGGAGCAAGCTCTCCGCTGAGGACAAGGAAAGAAGACCGAGGATTCGGCCGCCGTATTCGGCCGCCGTGAAGCGAGAGAAAGCGAGAGAAGTTCCGCGTCGTGCTTCGTGCTGGACGACATGCGCAAACTGCGCAAACTGCAAGACTACGGCCAGAGTGCCCAACCATGTAGTGGCTGACGTGGCTGACGGAGCACGATAGTCTCACGATAGTCTCGTGGTGTGCCAATT

Full Affymetrix probeset data:

Annotations for 1639148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720