FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639150_at:

>probe:Drosophila_2:1639150_at:62:67; Interrogation_Position=13; Antisense; ATGGCATCCAGAATCCGTAGAGAAG
>probe:Drosophila_2:1639150_at:80:261; Interrogation_Position=252; Antisense; CACCACCACCGAAAAGTCGAAGAAG
>probe:Drosophila_2:1639150_at:654:209; Interrogation_Position=274; Antisense; AAGAAGCGTAACAGGCGCCGCAGGC
>probe:Drosophila_2:1639150_at:652:485; Interrogation_Position=29; Antisense; GTAGAGAAGTCACCATGCGTCCTAT
>probe:Drosophila_2:1639150_at:418:271; Interrogation_Position=306; Antisense; CATCATCCGTCGCAGGGAACGAAGA
>probe:Drosophila_2:1639150_at:212:381; Interrogation_Position=322; Antisense; GAACGAAGAGACGAACGTGGTGAAC
>probe:Drosophila_2:1639150_at:522:107; Interrogation_Position=33; Antisense; AGAAGTCACCATGCGTCCTATTCTT
>probe:Drosophila_2:1639150_at:448:45; Interrogation_Position=395; Antisense; ATCGCGGTAGCGACGGTGAACGCAT
>probe:Drosophila_2:1639150_at:198:275; Interrogation_Position=417; Antisense; CATTGTGAGGCGTTATGTGGTCCGT
>probe:Drosophila_2:1639150_at:51:63; Interrogation_Position=431; Antisense; ATGTGGTCCGTGAGCGCCGCTTCAG
>probe:Drosophila_2:1639150_at:285:609; Interrogation_Position=441; Antisense; TGAGCGCCGCTTCAGACGCTACTAA
>probe:Drosophila_2:1639150_at:642:277; Interrogation_Position=50; Antisense; CTATTCTTGTGCTATCCCTGGTCAT
>probe:Drosophila_2:1639150_at:501:725; Interrogation_Position=56; Antisense; TTGTGCTATCCCTGGTCATCTTGGC
>probe:Drosophila_2:1639150_at:703:305; Interrogation_Position=66; Antisense; CCTGGTCATCTTGGCCACGCTGGTT

Paste this into a BLAST search page for me
ATGGCATCCAGAATCCGTAGAGAAGCACCACCACCGAAAAGTCGAAGAAGAAGAAGCGTAACAGGCGCCGCAGGCGTAGAGAAGTCACCATGCGTCCTATCATCATCCGTCGCAGGGAACGAAGAGAACGAAGAGACGAACGTGGTGAACAGAAGTCACCATGCGTCCTATTCTTATCGCGGTAGCGACGGTGAACGCATCATTGTGAGGCGTTATGTGGTCCGTATGTGGTCCGTGAGCGCCGCTTCAGTGAGCGCCGCTTCAGACGCTACTAACTATTCTTGTGCTATCCCTGGTCATTTGTGCTATCCCTGGTCATCTTGGCCCTGGTCATCTTGGCCACGCTGGTT

Full Affymetrix probeset data:

Annotations for 1639150_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720