FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639152_at:

>probe:Drosophila_2:1639152_at:113:373; Interrogation_Position=3708; Antisense; GAAGGTGATCCACTACTATTTCAAA
>probe:Drosophila_2:1639152_at:614:179; Interrogation_Position=3730; Antisense; AAAAAGTGGCCCGATCACGGCGTGC
>probe:Drosophila_2:1639152_at:485:301; Interrogation_Position=3754; Antisense; CCCGAGGATCCCATGCATTTGATTA
>probe:Drosophila_2:1639152_at:298:5; Interrogation_Position=3826; Antisense; ATTGTCGTCCATTGCAGTGCGGGAG
>probe:Drosophila_2:1639152_at:407:407; Interrogation_Position=3858; Antisense; GACGGGCACGTTTATTGGCCTGGAT
>probe:Drosophila_2:1639152_at:240:579; Interrogation_Position=3874; Antisense; GGCCTGGATCTGATCATGCAGCGAT
>probe:Drosophila_2:1639152_at:446:183; Interrogation_Position=3938; Antisense; AAAAGCTGCGATTCCAGCGCATGAA
>probe:Drosophila_2:1639152_at:100:177; Interrogation_Position=3971; Antisense; AAACGCAGCAGCAGTACACATTCCT
>probe:Drosophila_2:1639152_at:24:135; Interrogation_Position=3998; Antisense; ACGCCTGCACCTATGAGCTGGTCAA
>probe:Drosophila_2:1639152_at:258:167; Interrogation_Position=4049; Antisense; AAATGGATGGGCGTCCCAAGTCCGT
>probe:Drosophila_2:1639152_at:176:171; Interrogation_Position=4101; Antisense; AAAGGTGAGCTTTCCGGACGTGGAT
>probe:Drosophila_2:1639152_at:444:85; Interrogation_Position=4132; Antisense; AGTGAGTATGTGTCATCCGCACCGA
>probe:Drosophila_2:1639152_at:598:353; Interrogation_Position=4150; Antisense; GCACCGATCACCGATTTGGATGACG
>probe:Drosophila_2:1639152_at:467:177; Interrogation_Position=4239; Antisense; AAACGATAACCCAACTAGCAGCAGC

Paste this into a BLAST search page for me
GAAGGTGATCCACTACTATTTCAAAAAAAAGTGGCCCGATCACGGCGTGCCCCGAGGATCCCATGCATTTGATTAATTGTCGTCCATTGCAGTGCGGGAGGACGGGCACGTTTATTGGCCTGGATGGCCTGGATCTGATCATGCAGCGATAAAAGCTGCGATTCCAGCGCATGAAAAACGCAGCAGCAGTACACATTCCTACGCCTGCACCTATGAGCTGGTCAAAAATGGATGGGCGTCCCAAGTCCGTAAAGGTGAGCTTTCCGGACGTGGATAGTGAGTATGTGTCATCCGCACCGAGCACCGATCACCGATTTGGATGACGAAACGATAACCCAACTAGCAGCAGC

Full Affymetrix probeset data:

Annotations for 1639152_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720