Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639154_at:

>probe:Drosophila_2:1639154_at:303:489; Interrogation_Position=1023; Antisense; GTACGACGAGATTCGCTACCACCAA
>probe:Drosophila_2:1639154_at:569:141; Interrogation_Position=1074; Antisense; ACGGAGCCATCAGCATGTTCAGCAC
>probe:Drosophila_2:1639154_at:678:379; Interrogation_Position=1149; Antisense; GAACGACCAGTTCTCCAATGGAAGT
>probe:Drosophila_2:1639154_at:536:65; Interrogation_Position=1166; Antisense; ATGGAAGTGTTCATCCGCATCAGCG
>probe:Drosophila_2:1639154_at:306:647; Interrogation_Position=1197; Antisense; TCATGTCACCCACTTGATAATTCCG
>probe:Drosophila_2:1639154_at:562:453; Interrogation_Position=1212; Antisense; GATAATTCCGCCACAGAACTCAAAC
>probe:Drosophila_2:1639154_at:406:193; Interrogation_Position=1228; Antisense; AACTCAAACTTCTTGCAGGTTCCTG
>probe:Drosophila_2:1639154_at:230:227; Interrogation_Position=751; Antisense; AATGCCAACGGAACGGTGACCACGC
>probe:Drosophila_2:1639154_at:481:133; Interrogation_Position=772; Antisense; ACGCTGCCTGCAAATCCGGAAGTGG
>probe:Drosophila_2:1639154_at:187:371; Interrogation_Position=790; Antisense; GAAGTGGTTCTCACCGAAGCCGCGG
>probe:Drosophila_2:1639154_at:416:681; Interrogation_Position=904; Antisense; TATGATAGTCCCAGCAACAACTCCT
>probe:Drosophila_2:1639154_at:477:369; Interrogation_Position=960; Antisense; GAAGGAGTCACTCTACTCGGTGGTT
>probe:Drosophila_2:1639154_at:693:531; Interrogation_Position=978; Antisense; GGTGGTTTCGCCCAAGTCTCGAAAG
>probe:Drosophila_2:1639154_at:142:169; Interrogation_Position=999; Antisense; AAAGGGAAGCCTGGACTCGCATCTG

Paste this into a BLAST search page for me
GTACGACGAGATTCGCTACCACCAAACGGAGCCATCAGCATGTTCAGCACGAACGACCAGTTCTCCAATGGAAGTATGGAAGTGTTCATCCGCATCAGCGTCATGTCACCCACTTGATAATTCCGGATAATTCCGCCACAGAACTCAAACAACTCAAACTTCTTGCAGGTTCCTGAATGCCAACGGAACGGTGACCACGCACGCTGCCTGCAAATCCGGAAGTGGGAAGTGGTTCTCACCGAAGCCGCGGTATGATAGTCCCAGCAACAACTCCTGAAGGAGTCACTCTACTCGGTGGTTGGTGGTTTCGCCCAAGTCTCGAAAGAAAGGGAAGCCTGGACTCGCATCTG

Full Affymetrix probeset data:

Annotations for 1639154_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime